Busch Lab

ZMP

si:dkeyp-73d8.3

Ensembl ID:
ENSDARG00000077075
ZFIN ID:
ZDB-GENE-070912-680
Description:
hypothetical protein LOC564534 [Source:RefSeq peptide;Acc:NP_001164290]
Human Orthologue:
FASTK
Human Description:
Fas-activated serine/threonine kinase [Source:HGNC Symbol;Acc:24676]
Mouse Orthologue:
Fastk
Mouse Description:
Fas-activated serine/threonine kinase Gene [Source:MGI Symbol;Acc:MGI:1913837]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa2038 Nonsense F2 line generated Not yet available
sa682 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2038
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114721 Nonsense 438 914 3 9
ENSDART00000134125 Nonsense 438 914 4 10
Genomic Location (Zv9):
Chromosome 2 (position 32306594)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32605501
GRCz11 2 32588719
KASP Assay ID:
554-2677.1 (used for ordering genotyping assays)
KASP Sequence:
TGCCTAAGAAGGTTGACAGCATCACACCTTACACCATGGCTCTCATCGCC[A/T]AGTACATTGCTCGCCATCGTCTGAGAGAAACACGCTTGCTAGACACTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa682
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114721 Nonsense 593 914 5 9
ENSDART00000134125 Nonsense 593 914 6 10
Genomic Location (Zv9):
Chromosome 2 (position 32302549)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32601456
GRCz11 2 32584674
KASP Assay ID:
554-0590.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCTCATGTTCGACCATGCTTTAACAGCTGATGAGGTGAACCGCAAATA[C/A]AGGTAAGAGATGTCAGAAAACGACCTGTAAATCTATAAAAAGAATTGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25843
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114721 Nonsense 895 914 9 9
ENSDART00000134125 Nonsense 895 914 10 10
Genomic Location (Zv9):
Chromosome 2 (position 32297209)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32596116
GRCz11 2 32579334
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTATTTGACTTTCTTCATTGTAGTTGCCCTATCTGGAGTTGGAGAAGT[T/A]GAACGGGATCGAGGAAGTCAAGCAGTACCTACACAAAAAGCTGCTGGAGG
Associated Phenotype:
Not determined