Busch Lab

ZMP

RBM6

Ensembl ID:
ENSDARG00000077060
Description:
RNA binding motif protein 6 [Source:HGNC Symbol;Acc:9903]
Human Orthologue:
RBM6
Human Description:
RNA binding motif protein 6 [Source:HGNC Symbol;Acc:9903]
Mouse Orthologue:
Rbm6
Mouse Description:
RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa20795 Nonsense Available for shipment Available now
sa40771 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40772 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33940 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26808
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Splice Site, Nonsense 648 1393 4 23
Genomic Location (Zv9):
Chromosome 6 (position 42606112)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42677166
GRCz11 6 42674702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACAAACACTATTGCCATCTCTGGAATTCCTAAAAATGCCACAATGCAG[C/T]AGGTGAGTGAGATTTCATTAGGTTTTTATTGTTTTTAGAGACTTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20795
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Nonsense 673 1393 6 23
Genomic Location (Zv9):
Chromosome 6 (position 42607372)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42678426
GRCz11 6 42675962
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATTAACTAACGCAAATCCATCTGTATTTCAAATGCTGTTCCCAGGTTA[C/A]AGCTTCGATACGGCCTATGTGGAGTTTTTAAACCTCGAGGATGCTGTCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8241
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Nonsense 785 1393 8 23
Genomic Location (Zv9):
Chromosome 6 (position 42611547)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42682601
GRCz11 6 42680137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAACTTGACTCCTGAAGCATGGCAACAGCAAGTGGACCAACAGCAACAA[C/T]AGCAGGAACTGGAGCAACAACCCACAGAAGAATGGACCAATCAGAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40771
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Essential Splice Site 817 1393 8 23
Genomic Location (Zv9):
Chromosome 6 (position 42611647)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42682701
GRCz11 6 42680237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCACGCCAAAACTTACAGTACTCTGATCCAGTTTTTAAAGAAAGCAAAA[G/T]TAAGTCATGTCAGCTGCGACTGAGATTTTTCAATTAAGGAAAATGGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40772
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Essential Splice Site 870 1393 9 23
Genomic Location (Zv9):
Chromosome 6 (position 42611888)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42682942
GRCz11 6 42680478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCACCTGGATCCAAATGCTTCTGCTTTGTTGATATGGATTCACATGAG[G/T]TGAGATGTACAGAATTATGATTATAACAAAGACAATATGATGTCTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33940
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Nonsense 1105 1393 16 23
Genomic Location (Zv9):
Chromosome 6 (position 42614422)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42685476
GRCz11 6 42683012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTCCTGTGACTCCTGTTGCTGAGGTTATAGCTGTACCCATTAAAGAA[G/T]AGGAAGCCAAGGCGGTTTCAGAGGCTTTGCCAGAGGTGCGGGTGGAAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26809
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Nonsense 1338 1393 21 23
Genomic Location (Zv9):
Chromosome 6 (position 42621357)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42692411
GRCz11 6 42689947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAACTAAAGCGCCAGGCAGCTCGCCTGAAGCAAAAAGAAGAAAGCCA[C/T]AAAATACTTGGGCCGGCAGCTCAAGGTTTTTGATTTTCTGAACTTTAATA
Associated Phenotype:
Not determined