Busch Lab

ZMP

fam198b

Ensembl ID:
ENSDARG00000077054
ZFIN ID:
ZDB-GENE-100105-1
Human Orthologue:
FAM198B
Human Description:
family with sequence similarity 198, member B [Source:HGNC Symbol;Acc:25312]
Mouse Orthologue:
Fam198b
Mouse Description:
family with sequence similarity 198, member B Gene [Source:MGI Symbol;Acc:MGI:1915909]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13448 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13448
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112379 Nonsense 79 479 1 4
Genomic Location (Zv9):
Chromosome 14 (position 37103011)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35542338
GRCz11 14 35882652
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGATAAACGSCCGGAACTGTGGACTGGAAATGGCGTTTATTCTCAGAGT[A/T]AAACTGACCAGGGCCTCACCGATGGGGAGGTGAATGAATCCGTGAGTCCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28344
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112379 Essential Splice Site 265 479 1 4
Genomic Location (Zv9):
Chromosome 14 (position 37102449)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35541776
GRCz11 14 35882090
KASP Assay ID:
2260-7774.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGAACAGAACCTTGCCAGCTGTCAGCAGGAGATTCCACTCTCTTGGAG[G/A]TATTGATATTAAACACATCTGTGTGTCGTTTTTTTGTACACTGTAACCCA
Associated Phenotype:
Not determined