Busch Lab

ZMP

ABCC8 (3 of 3)

Ensembl ID:
ENSDARG00000077007
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Human Orthologue:
ABCC8
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Mouse Orthologue:
Abcc8
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1352629]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18215 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18215
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098668 Essential Splice Site 32 562 2 14
Genomic Location (Zv9):
Chromosome 18 (position 48913062)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50060140
GRCz11 18 50056705
KASP Assay ID:
2261-2657.1 (used for ordering genotyping assays)
KASP Sequence:
CTGAACTGTWGGAAAGYGTTCAGCAGTGTTTTCAGTGTGTGTTTCTCWGT[A/G]GATTATAGCCATGCGGGACGGGACGGKACAGACTCAGGGGACTCTGAAGG
Long Flanking Sequence:
GACACCTCCTGGACACCTACCTATGAAGGTGTTCCAGGCATGTCCCACCGGGAGGAGTTCTGGAGGGATTATGTCTCTCGGCTGGCCTGGGAACGGGATCTCAGGATCCACCCTGAGGAGCTGGAGGAAGTGTCTGGGGAGAAGGAAGTCTGTGGTTCTCTCCTGAGACTGCTGCCCCCGCAACCCGGCCCTGGATAAGCAGTAGAAAATGAATGAGTGAATGCTGCTGTGCTGATTGTTAAAGACCTCAGCCCTCCGCCAGTCTCCCAACTGAGAATCCCAACAGTGCAGCGAAATCCACTTCTCTCAGTGATATCTGTGACAGTTTAGCAGAAACTGAGGAGTTTCTTCTCTCTGATTCGAGACGCTGCATTATTCACTAATGTTTTGTGCATAAATCTAATTGACATCTTTAAATGAAAGCACAGCTATTGACTGACTCCAGTCTGTCTGAACTGTTGGAAAGCGTTCAGCAGTGTTTTCAGTGTGTGTTTCTCTGT[A/G]GATTATAGCCATGCGGGACGGGACGGTACAGACTCAGGGGACTCTGAAGGACATCCAGTGTGCAGAACCGGAGCTGTTTGAGCAGTGGAGAACTCTGATGAACAGACAGGACAAAGTAGGAAGAGCTTACTTTATAATATAATGTCCAAAATGAAATACATTTAAATATTGGTTTATTTTTATGTGTATTTAATTAACTTAATTAACATTTGTATTATTTATAAAACCCTTTTATATAATGATCTTCTAATATAGAACTTATCTGCAGTGTTGTTGGTATTTATCTGCAGGAGAACTCGACTGAACTGAAGAGGAAGAGTTTCAGACGGGCGATGATGTACTCCAGAGATACCGTGGCCACTGATGATGAAGACGAAGGTAAAAACACTGTGCTACTCTATTCGTCATGAGTACACCTGGACACATAAATCATTTAATGAATTTTTTTTTTTATGAATTCAAATGTCAATATTAGGCATATTTAATATTTTTAAATATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29103
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098668 Nonsense 312 562 7 14
Genomic Location (Zv9):
Chromosome 18 (position 48906310)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50053610
GRCz11 18 50050175
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTTACCGTCGCCTGCTACTTCATCCAGAAATACTTCAGGGTGGCGTCC[A/T]GGTCAGTCGCAATATATAAAGCAGAATCAAAGGAACATTTACGCTGCTTC
Long Flanking Sequence:
GCGGATCATCGTCCTCGCACCAATGAGGTCTGTGTGAGATGCGATCAACATTCATTTTAAAGGGGAGCTATTGTGCAAAAATCCCTTTTATGAGTGGAGGGAGCATCAAAGAACTTTAGACTTTAAAAACTGAATGCACAAACTCTTCTGTGTTTTAGATTGTTTGAGACGACTCCACTGGGGAACATACTGAACCGATTCTCAACGGACACTAACACTATTGACCAGGTAGTGTAAAATACAAAATCACAGAAATGTTAGACAACGACGAACATATAATACTTCACAATACTCACACTAATATGTGAATGAATAAATGTGGTATATTTATGTGTGTGATTCAGCATATTCCGGTGACCATGGAGTGTCTGAGCCGCTCGACTCTGCTGTGTGTTTCTGCTGTGGGCGTGATCTCATACGTCACTCCAGTGTTTCTTATCGCTCTGCTGCCGCTTACCGTCGCCTGCTACTTCATCCAGAAATACTTCAGGGTGGCGTCC[A/T]GGTCAGTCGCAATATATAAAGCAGAATCAAAGGAACATTTACGCTGCTTCACTATTGAGATTATAGCAAACCAGCTAATGAACCATTCAACCACCAACCATTCATCCAATCATTCATTCATCCAACCAATCAACCAATCAACCAACATACCAACCATTCGTCCAACCAACCGTCTAACCAACCAACCACTCACCCACTGACCCAACCAACCAACCAATCGACTGACCAACTGACTGACCGTCCAACCAACCAACCAACCAACCAACCAACCAAACTACTAACCAATCCACCCATTCGTCCAACCAACCAACCACTTACCTAATGACCCAACTAACCAACCACCAGACCGACCGACCAACTGACTGACCGACCGACCAACCAACCGTCCAACCAACCAACCAACCAACCCAACCAACCAACCGACCAACTGACAGACCAACCGTCCAACATCTATCCAACCAAACAACCAACCCAACCAACTAACCAACCCACAGACCAAC
Associated Phenotype:
Not determined