Busch Lab

ZMP

aldh1l1

Ensembl ID:
ENSDARG00000077004
ZFIN ID:
ZDB-GENE-100519-4
Description:
aldehyde dehydrogenase 1 family, member L1 [Source:RefSeq peptide;Acc:NP_001185701]
Human Orthologue:
ALDH1L1
Human Description:
aldehyde dehydrogenase 1 family, member L1 [Source:HGNC Symbol;Acc:3978]
Mouse Orthologue:
Aldh1l1
Mouse Description:
aldehyde dehydrogenase 1 family, member L1 Gene [Source:MGI Symbol;Acc:MGI:1340024]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa20698 Essential Splice Site Available for shipment Available now
sa18221 Splice Site, Nonsense Available for shipment Available now
sa40691 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12463 Nonsense Available for shipment Available now
sa20699 Nonsense Available for shipment Available now
sa20700 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20698
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Essential Splice Site 240 904 5 23
Genomic Location (Zv9):
Chromosome 6 (position 23763619)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20019065
GRCz11 6 22079287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGAGGAAATGACAGAGTACCTGGAGCCTGGGCAGAGATAGATGGCAAA[G/A]TGAGTGTTTTTCCTCTTAACAACAACAATACACCAAACATGCTCTCTTAA
Long Flanking Sequence:
TGGACACAGGACCAATTCTTTTGCAAAGAGAATGTGATGTTGAGCCAAATGACAACGTAAACAGCATCTACAAGCGCTTCCTGTTTCCAGAGGGAGTCAAGGGCATGGTGTGGATTATTGCAGTAATCAGAACTAGCATAGCATATTTGCATATGATCATTCAAAGTCCAGGAAGTAGTCTGATTTAGTTGTTAAGAATGACTTCACCCATGGATTTAATTTTGTGTGCATGTAGGTAGAGGCAGTCAGGTTGATTGCAACAGGGAAAGCTCCAAGAATCAAGCAACCAGAAGAAGGAGCCACATATGAGTGTATTCAGAAGAAAGAAAATTCAAAGGTGATATATTGATATATAGTTTGTCTAATTCTAATTGTTGTTTCACAATAACCATTTGTGGTTGTTTGCATAGATTGACTGGAATCAACCAGCAGAAGCCATTCATAACTGGATCAGAGGAAATGACAGAGTACCTGGAGCCTGGGCAGAGATAGATGGCAAA[G/A]TGAGTGTTTTTCCTCTTAACAACAACAATACACCAAACATGCTCTCTTAAAGGGCACCTATGATGAAAATCATCTTTTGGAAGCTGTTTGGACAGAACTGTGTGTAGGTAGGACCACAGTCATACTGGGGTGATACAAAGACAATAAGTCTTGGAACCATGAATTCTGCTGTGTGCCAAAATATTCTGTATGAGAATGTTCGACCATCTGTTAGTGACCTCAAGCTGAAGCGAACTTGGGTTCTGTAGCTGGACAATGATCCTAAGCACAACAGCAAGTCCACTTCTGAATGATTGAAGAAAAACAAAATAAAGACTTTGGTGTGACCGAGTCAGAGTACTGACCTGAATCCAATTGAGATGCTGTTGCATGACCTTAAAAAGACAATTCATGCTCACAAACCCTCCAATGGGCTGAATCGGAACAATTCTACAAAGATGAGTGTGCCAAAATTCCTCCACAGTACTGTAACAGACTCATTGCAAGTTATCGAAAATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18221
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Splice Site, Nonsense 450 904 11 23
Genomic Location (Zv9):
Chromosome 6 (position 23772498)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20027944
GRCz11 6 22088166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGKATGCGGAAGGRGGAAARACCTATAAGAGCATTAACCCTACTGACGGA[C/T]AAGTACATACTGGGCACACATCTCTTTTTCTATTCATANTTTTTCCTCAA
Long Flanking Sequence:
GAATAATATTTGTGTAGTGTCAGGAAATAATTATGCCAATCTAACATTTTTACATGATTTAGAGAAGAATAAAGTAATGATATATGGATACGTCTACTTGTATGTCTTTTCAAACATATTTAAAACATTATAAAATTTAGCCCCAAAATATGAATTTAATATAACGTATAGAATAAATATATTGTTTACATATATTACAAAAAATTGACAGTAGAATATTATTTCCTCAACCTTAACATGTATTGCTGATATTAAAAAGCCGGAATGCATATAAAAAAAGTCAGTTATTTCAATTGATTCACTCTAATGCTCTAATTGATTCATTTTTTTATTTTTATCTATATCTATTTATTTTTAATTATGTGTTTGCATGTCTGTTGTAGGTAGAAAAGAAACTGAACAATATGACAATTCACATCCCCCACCAGCTTTTCATAAATGGGGAATTTGTGGATGCGGAAGGGGGAAAGACCTATAAGAGCATTAACCCTACTGACGGA[C/T]AAGTACATACTGGGCACACATCTCTTTTTCTATTCATATTTTTTCCTCAACTTCCATATGCTCAATATCAACTTCTGTTTGTGTGTAGGTAATCTGCGACGTGTCTTTAGCTCAGATCTCTGATGTGGAAAAAGCAGTCGCTGCAGCTAAAGAAGCTTTTGAGGAAGGAGAGTGGGGAAAGATGAACCCCAGAGACAGAGGCAAGCTGCTTTACAAGTATGTTAATGATTTATTTTACCTAACATTTAAAGTATATATGAAATCAAAACTAAACATATTTATTTTGTAACTATGAAAACACTATGAAAACAAACAGATCTGATGTTAGGTTGTAATTTGGGGATAACACACAGTTTGAACCCAAAGAATGACCAGTCTGTCAAATGAAGAAGAGCCGGAGACAGTTTGCAGTTTTATCAGCAGAAGCCAGCTTTAACACTCGCAATGAGTTCCCAGGCCTCTCTTCTTACAATCACAAATCAATAACAATTATACTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40691
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Essential Splice Site 451 904 12 23
Genomic Location (Zv9):
Chromosome 6 (position 23772586)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20028032
GRCz11 6 22088254
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTTTCCTCAACTTCCATATGCTCAATATCAACTTCTGTTTGTGTGTA[G/A]GTAATCTGCGACGTGTCTTTAGCTCAGATCTCTGATGTGGAAAAAGCAGT
Long Flanking Sequence:
TACGTCTACTTGTATGTCTTTTCAAACATATTTAAAACATTATAAAATTTAGCCCCAAAATATGAATTTAATATAACGTATAGAATAAATATATTGTTTACATATATTACAAAAAATTGACAGTAGAATATTATTTCCTCAACCTTAACATGTATTGCTGATATTAAAAAGCCGGAATGCATATAAAAAAAGTCAGTTATTTCAATTGATTCACTCTAATGCTCTAATTGATTCATTTTTTTATTTTTATCTATATCTATTTATTTTTAATTATGTGTTTGCATGTCTGTTGTAGGTAGAAAAGAAACTGAACAATATGACAATTCACATCCCCCACCAGCTTTTCATAAATGGGGAATTTGTGGATGCGGAAGGGGGAAAGACCTATAAGAGCATTAACCCTACTGACGGACAAGTACATACTGGGCACACATCTCTTTTTCTATTCATATTTTTTCCTCAACTTCCATATGCTCAATATCAACTTCTGTTTGTGTGTA[G/A]GTAATCTGCGACGTGTCTTTAGCTCAGATCTCTGATGTGGAAAAAGCAGTCGCTGCAGCTAAAGAAGCTTTTGAGGAAGGAGAGTGGGGAAAGATGAACCCCAGAGACAGAGGCAAGCTGCTTTACAAGTATGTTAATGATTTATTTTACCTAACATTTAAAGTATATATGAAATCAAAACTAAACATATTTATTTTGTAACTATGAAAACACTATGAAAACAAACAGATCTGATGTTAGGTTGTAATTTGGGGATAACACACAGTTTGAACCCAAAGAATGACCAGTCTGTCAAATGAAGAAGAGCCGGAGACAGTTTGCAGTTTTATCAGCAGAAGCCAGCTTTAACACTCGCAATGAGTTCCCAGGCCTCTCTTCTTACAATCACAAATCAATAACAATTATACTCTCTACACAAGACCAGAAAGAGTGTGATTCAGGTAACAGGTTTTCATTGGTTAAAACAAAGATAGACAGCCCTAAATAGGTACGTCGATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12463
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Nonsense 457 904 12 23
Genomic Location (Zv9):
Chromosome 6 (position 23772606)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20028052
GRCz11 6 22088274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCTCAATATCAACTTCTGTTTGYGTGTAGGYAATCTGYGACGTGTCTT[T/A]AGCTCAGATCTCTGATGTGGAAAAAGCAGTCGCTGCAGCTAAAGAAGCTT
Long Flanking Sequence:
TTCAAACATATTTAAAACATTATAAAATTTAGCCCCAAAATATGAATTTAATATAACGTATAGAATAAATATATTGTTTACATATATTACAAAAAATTGACAGTAGAATATTATTTCCTCAACCTTAACATGTATTGCTGATATTAAAAAGCCGGAATGCATATAAAAAAAGTCAGTTATTTCAATTGATTCACTCTAATGCTCTAATTGATTCATTTTTTTATTTTTATCTATATCTATTTATTTTTAATTATGTGTTTGCATGTCTGTTGTAGGTAGAAAAGAAACTGAACAATATGACAATTCACATCCCCCACCAGCTTTTCATAAATGGGGAATTTGTGGATGCGGAAGGGGGAAAGACCTATAAGAGCATTAACCCTACTGACGGACAAGTACATACTGGGCACACATCTCTTTTTCTATTCATATTTTTTCCTCAACTTCCATATGCTCAATATCAACTTCTGTTTGTGTGTAGGTAATCTGCGACGTGTCTT[T/A]AGCTCAGATCTCTGATGTGGAAAAAGCAGTCGCTGCAGCTAAAGAAGCTTTTGAGGAAGGAGAGTGGGGAAAGATGAACCCCAGAGACAGAGGCAAGCTGCTTTACAAGTATGTTAATGATTTATTTTACCTAACATTTAAAGTATATATGAAATCAAAACTAAACATATTTATTTTGTAACTATGAAAACACTATGAAAACAAACAGATCTGATGTTAGGTTGTAATTTGGGGATAACACACAGTTTGAACCCAAAGAATGACCAGTCTGTCAAATGAAGAAGAGCCGGAGACAGTTTGCAGTTTTATCAGCAGAAGCCAGCTTTAACACTCGCAATGAGTTCCCAGGCCTCTCTTCTTACAATCACAAATCAATAACAATTATACTCTCTACACAAGACCAGAAAGAGTGTGATTCAGGTAACAGGTTTTCATTGGTTAAAACAAAGATAGACAGCCCTAAATAGGTACGTCGATGCGGGGTCGTATCTGAATCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20699
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Nonsense 553 904 14 23
Genomic Location (Zv9):
Chromosome 6 (position 23777592)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20033038
GRCz11 6 22093260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTCTAATATTATTTTCCACAGGGCTGCACTATTCCCATAAACCAGGCT[C/T]GACCTAATCGAAACCTTACCTTTACCAAGAAAGAGCCCATTGGGTAAAAT
Long Flanking Sequence:
GCAGAGGAACAATTTTGAGTATGGATAAAACCATAGCCTTCACTTGAGCATTTGTGGCAAAGTTGATTGAGACCAAAATAATTATATTTTTTTTACATTGAAATACTTAGAAGGGAATCAATCCAATCTCTAAACATATAGTTTAAAAATGTAATGTAAATGATTTTAACATAATATAGTGTGGAAAATAGTGGCTTGCCAACATTTTCAGGATGAAGTTATGTCTAATTGTTTTACATTTTAAATTTAACATAGTAAAGTCCTCAAATTATTATTTTTTTCAATTCATGCTCCTAATGACCCTAAATATTATTCAGCCCAGAATATTCTTTTAAAGGTTATTTTACTACATTATATTCCAAAACAATACTGTCACTCTTAATAGTAGAGTGACTAATGATTTTGTTATATATGACTGGAAACTGTGGTTTTACTAAAATCTGTCTTTGTGTTTCTAATATTATTTTCCACAGGGCTGCACTATTCCCATAAACCAGGCT[C/T]GACCTAATCGAAACCTTACCTTTACCAAGAAAGAGCCCATTGGGTAAAATTAAGCCTCTCTTTAATAAAACGTTTTCTTCCAGTCTTGTCATAATGAAACAAAATAATCTTGATGAACTCAAATCAAGTATTTGGTGCATGTGGAACGAGCAATGATAACATTTGGCTCTTTTTGTTTGGGTAAAGTGTGTGCGGCATTGTAATTCCATGGAATTATCCACTGATGATGCTGGCTTGGAAAACTGCGGCCTGCCTGGCTGCTGGAAATACTGTAGTTCTTAAACCTGCCCAGGTAAACACCTGCAGTTACAGCTCAATCTAACATGCGACATATAAAAACATACAACATAAGGACTGAGTAAGTGTTTCTTTGTTGATTTTTAGGTCACACCTTTGACTGCTCTCAAATTTGCTGAATTAACTGCTCTGGCAAAATTTCCAAAAGGAGTGGTGAACATACTACCTGGATCAGGTATAAATAAAACATTCACAGAACAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa15821
Status:
No KASP design
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Essential Splice Site 632 904 17 23
Genomic Location (Zv9):
Chromosome 6 (position 23778237)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20033683
GRCz11 6 22093905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTAACTGCTTGYAGATGAATWGCATTTTTATYAAATKTGTACATTTCA[G/A]GGTCTTTGGTTGGTCAGCGACTYTCTGAYCAYCCKGATGTCCGMAAACTG
Long Flanking Sequence:
AACGAGCAATGATAACATTTGGCTCTTTTTGTTTGGGTAAAGTGTGTGCGGCATTGTAATTCCATGGAATTATCCACTGATGATGCTGGCTTGGAAAACTGCGGCCTGCCTGGCTGCTGGAAATACTGTAGTTCTTAAACCTGCCCAGGTAAACACCTGCAGTTACAGCTCAATCTAACATGCGACATATAAAAACATACAACATAAGGACTGAGTAAGTGTTTCTTTGTTGATTTTTAGGTCACACCTTTGACTGCTCTCAAATTTGCTGAATTAACTGCTCTGGCAAAATTTCCAAAAGGAGTGGTGAACATACTACCTGGATCAGGTATAAATAAAACATTCACAGAACAAATGTATATTCTGACATGTATGATGTACTCTCTCTTTGTTTTGGAGATCATTTAATATTAACATTAGTCTGTTTAACACAAATTGGATCATTTTTGAGGTTAACTGCTTGTAGATGAATTGCATTTTTATCAAATGTGTACATTTCA[G/A]GGTCTTTGGTTGGTCAGCGACTTTCTGACCACCCGGATGTCCGCAAACTGGGCTTCACTGGCTCTACTGAGATTGGCAAACATATCATGAAAAGGTAAATATATGCATGTTTTTAAAATGTAATGTTTTCTTGTCAAAGTTTTTAGACTAGGGGGTGGCATTCAATAGTTTCACGCAGGTTTTCTTTTGGGTAGCATATTTGGGTAAAGCATTGCAATTGGTGACATTTTACATTTATTTATTTCAAATAAAACCATATTGCATATTTATGTTGTTGTATCTGTCCAAATACATGATCAGTCACATCTTGTGCCTGAGGGTATAGATCAGGGGTGTCCAAACTTTTTCTTATGATGGGCAAAAACCACACTTGATTGAGGGTGTTGGGCCGAAGCTAAATATACCAAACTGTGCTACGTTGAAGTTGCCATGGTAACTTCCTAACTTAGTATTATTTTAAAAGGATATAGAAAACATATTTTTATTGTATCAGTGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20700
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Nonsense 899 904 23 23
Genomic Location (Zv9):
Chromosome 6 (position 23786126)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20041572
GRCz11 6 22101794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTCCATACAGGTCAAGAAGCTCTGAATGAGTATCTGAAGACTAAATG[T/A]GTCACAGTGGAATACTAACTGACAAAACACTGGACGTATAGTAAAGATTA
Long Flanking Sequence:
TTCAGAGAACTTCAGCTGTATATAAAGCCAGCAATTTAAATGTGTACATTGCAATGATTTTTTTGAATTGTTACAATTTAGTAAGAATCTAAATCGGATATTTCTCATTTTTCTTGATTCAGAGAAGTTGACAAGGTGCTGCAGAGGGCTAATGCTACAGAATTTGGCTTAGCATCAGGTGTGTTTACACGTGACATTAGTAAGGCTCTCTATGTGAGTGAAAAGCTTCAGGCTGGCACTGTGTTCATCAACACGTACAACAAGACGGATGTAGCAGCTCCTTTTGGTGGCTTCAAACAATCTGGCTTTGGCAAAGATTTGGGTAAGACATAATACCTGGTGAATTCATTTAAATGCACATACATCTAACAGTTCAATGTGTGGTTACTAAACTAGATTTCAGTCATTTGTTAACTTGTAAGAAAGGAGTTTTTGTATAACACGGGGTGTCTTTTCCATACAGGTCAAGAAGCTCTGAATGAGTATCTGAAGACTAAATG[T/A]GTCACAGTGGAATACTAACTGACAAAACACTGGACGTATAGTAAAGATTACGGTATTTTAATGCTCTGAAGTGGCACTTCAGCTTGACCTTCAATAAATTGTCAAGTAAACTTAATCATTACATATATCTATGAATGAATGAACGAATTCCATTTCTTGAGACAATTAAAAAAATGAAATCTTGTGTTTTTCTAGTTTTGCATCATACCTGTAAATGTCTTGCTGTTTATAATATTGGAGAAATTCAAGGACCATGCATGAGACTTTATCAGTTATAATGGATGTTGTTTCACTTTATATCGTTTGCAGATCACTTGCTTAAGTTAAGAGACTGTGAAAAAGTTTTGGGTAAACCTGATTGACCCGTTGTCCTTCACTGCACTGATATTTTTGGATTGAACTGTAATAACTGAACTGTATTTTATACAGTTTTTAGAAACCAGAACTTTTTTAATTTCTTCCTTGTAAACAGATGAACATATTCCAAGGAAGTGCAAAAA
Associated Phenotype:
Not determined