Busch Lab

ZMP

si:dkey-208k22.3

Ensembl ID:
ENSDARG00000076972
ZFIN ID:
ZDB-GENE-070912-432
Description:
hypothetical protein LOC100136858 [Source:RefSeq peptide;Acc:NP_001108049]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19747 Nonsense Available for shipment Available now
sa18433 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19747
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081237 Nonsense 151 580 2 5
Genomic Location (Zv9):
Chromosome 2 (position 23495754)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24712741
GRCz11 2 24368392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAAGAATGGCAGCACCTCGCGCATGCCCTCCTGCATTTTGTCCAGATT[C/A]AAATGGTGAGATGGGTTTTCAGCATACTATTATCATTTTAAAATTTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18433
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081237 Essential Splice Site 153 580 2 5
Genomic Location (Zv9):
Chromosome 2 (position 23495761)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24712734
GRCz11 2 24368385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGCAGCACCTCGCGCATGCCCTCCTGCATTTTGTCCAGATTCAAATGG[T/C]GAGATGGGTTTTCAGCATACTATTATCATTTTAAAATTTACTTTACTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2076
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081237 Essential Splice Site 390 580 3 5
Genomic Location (Zv9):
Chromosome 2 (position 23497257)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24711238
GRCz11 2 24366889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTCACAAACACCATTGACAACCTCAATACCTCGCTTGCCAGCTGTAAG[G/A]TGAGTTTTTTAGACTTAATATAATTAATAGAATAATAATGTAATAATGTT
Associated Phenotype:
Not determined