Busch Lab

ZMP

ftr22

Ensembl ID:
ENSDARG00000076969
ZFIN ID:
ZDB-GENE-070912-321
Description:
Novel protein with Zinc finger, C3HC4 type (RING finger) and B-box zinc finger domains [Source:UniPr
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25914 Nonsense Mutation detected in F1 DNA Not yet available
sa5723 Essential Splice Site F2 line generated Not yet available
sa2070 Essential Splice Site F2 line generated Not yet available
sa19875 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25914
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098058 None None 488 None 7
ENSDART00000126740 Nonsense 43 381 1 5
Genomic Location (Zv9):
Chromosome 2 (position 48018087)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48049751
GRCz11 2 47903915
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCATCCCCTGTGGACACAGTTACTGTATGAGCTGCATTACTGACTGCTG[G/A]AATCAAGATGAGCAGAGGAGAGTTTACAGCTGCCCTCAGTGCAGACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5723
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098058 Essential Splice Site 17 488 2 7
ENSDART00000126740 None 86 381 1 5
ENSDART00000098058 Essential Splice Site 17 488 2 7
ENSDART00000126740 None 86 381 1 5
Genomic Location (Zv9):
Chromosome 2 (position 48017958)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48049622
GRCz11 2 47903786
KASP Assay ID:
554-3389.1 (used for ordering genotyping assays)
KASP Sequence:
AAYGTGATGCTGGCAGAAATGGTGGAGAAAGCAAAGGTGACAAGAAGAGM[C/T]CAAACAACTGACCCTGCTGTCAGTTACGCTGGAMGTGGAGATGTGGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2070
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098058 Essential Splice Site 17 488 2 7
ENSDART00000126740 None 86 381 1 5
ENSDART00000098058 Essential Splice Site 17 488 2 7
ENSDART00000126740 None 86 381 1 5
Genomic Location (Zv9):
Chromosome 2 (position 48017958)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48049622
GRCz11 2 47903786
KASP Assay ID:
554-3389.1 (used for ordering genotyping assays)
KASP Sequence:
AAYGTGATGCTGGCAGAAATGGTGGAGAAAGCAAAGGTGACAAGAAGAGC[C/T]CAAACAACTGACCCTGCTGTCAGTTACGCTGGAAGTGGAGATGTGGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19875
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098058 Nonsense 311 488 6 7
ENSDART00000126740 Nonsense 381 381 5 5
Genomic Location (Zv9):
Chromosome 2 (position 48014681)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48046345
GRCz11 2 47900509
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATCAACATTATTTCCAATAATGAACCCAAGACGAGGGAGGAGTTTCTA[C/T]AATGTAAGTCAATGTGGACACACACAAACACACTGGTTTGGGATCCCGTT
Associated Phenotype:
Not determined