Busch Lab

ZMP

cep70

Ensembl ID:
ENSDARG00000076965
ZFIN ID:
ZDB-GENE-070705-311
Description:
centrosomal protein of 70 kDa [Source:RefSeq peptide;Acc:NP_001108048]
Human Orthologue:
CEP70
Human Description:
centrosomal protein 70kDa [Source:HGNC Symbol;Acc:29972]
Mouse Orthologue:
Cep70
Mouse Description:
centrosomal protein 70 Gene [Source:MGI Symbol;Acc:MGI:1915371]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45758 Nonsense Mutation detected in F1 DNA Not yet available
sa8774 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45758
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115344 Nonsense 141 609 6 18

The following transcripts of ENSDARG00000076965 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 12757291)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12593221
GRCz11 22 12617998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCCTTTATTATAGTGGTTGTTGATGTTTGTGCCCGCACAGAAGTGTTG[T/A]CAGTCTGTGGAGCAGAAGCTGATTCAGGAGCAGCAGCAGGCCTCTCGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8774
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115344 Essential Splice Site 566 609 16 18

The following transcripts of ENSDARG00000076965 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 12746625)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12582555
GRCz11 22 12607332
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTCTGGACAGGAGATCTGCAGCCTTCTGGAAAGCMGCGACATTGACAG[G/A]TATGTGCGTCTSTTCATTTGAAYATCTKTWAACCTTTTCCGTTWTGACTC
Associated Phenotype:
Not determined