Busch Lab

ZMP

NP_001128580.1

Ensembl ID:
ENSDARG00000076931
Description:
calpain-7 [Source:RefSeq peptide;Acc:NP_001128580]
Human Orthologue:
CAPN7
Human Description:
calpain 7 [Source:HGNC Symbol;Acc:1484]
Mouse Orthologue:
Capn7
Mouse Description:
calpain 7 Gene [Source:MGI Symbol;Acc:MGI:1338030]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44395 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31119 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44395
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043112 Essential Splice Site 123 815 3 21
ENSDART00000043112 Essential Splice Site 123 815 3 21
Genomic Location (Zv9):
Chromosome Zv9_scaffold3563 (position 166531)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36183892
GRCz11 16 36192541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGGCCATTGAGCTCTACACTCAGGCTGTAGAGTTGTGCATTCAAGCGG[T/C]GAGGCCTCAAATATGGAGAAATGATTCCAATCAGATGTCAGTATATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31119
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043112 Essential Splice Site 123 815 3 21
ENSDART00000043112 Essential Splice Site 123 815 3 21
Genomic Location (Zv9):
Chromosome Zv9_scaffold3563 (position 166531)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36183892
GRCz11 16 36192541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGGCCATTGAGCTCTACACTCAGGCTGTAGAGTTGTGCATTCAAGCGG[T/C]GAGGCCTCAAATATGGAGAAATGATTCCAATCAGATGTCAGTATATTCAG
Associated Phenotype:
Not determined