Busch Lab

ZMP

si:dkey-159f12.3

Ensembl ID:
ENSDARG00000076923
ZFIN ID:
ZDB-GENE-081105-97
Description:
Kazrin-A [Source:UniProtKB/Swiss-Prot;Acc:A9C3W3]
Human Orthologue:
RP1-21O18.1
Human Description:
Kazrin [Source:UniProtKB/Swiss-Prot;Acc:Q674X7]
Mouse Orthologue:
9030409G11Rik
Mouse Description:
RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16379 Nonsense Available for shipment Available now
sa21311 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16379
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110432 Nonsense 58 814 1 16
ENSDART00000139787 Nonsense 58 786 1 15

The following transcripts of ENSDARG00000076923 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 27645400)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26773318
GRCz11 8 26792457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGAGCTGGAAGAACCGGGAGAACCGCAGGAACATCAGCAGCAGCAGCAA[C/T]AACAGAACCACCAGGGTAAGAAKCTGCACCTGTGACCGCTTATGTCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21311
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110432 Essential Splice Site 515 814 None 16
ENSDART00000139787 Essential Splice Site 487 786 None 15

The following transcripts of ENSDARG00000076923 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 27575855)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26703773
GRCz11 8 26722912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCCGATGTACATGCGCGCCTGTGCCGACAACGTCAAAAGCGGGAAGG[T/G]AAATGACAACCTGTCATTTTATTACTTAAACAGTTGTCTACGTCATTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5484
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110432 Nonsense 748 814 15 16
ENSDART00000139787 Nonsense 720 786 14 15

The following transcripts of ENSDARG00000076923 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 27569285)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26697203
GRCz11 8 26716342
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGGGGACTCCGCCCACACTCCACCGGCAGAGTTCTCTGAGCAGCTCAT[C/A]ACCAAGCTGTCMTRATGACCAGCAGTCTTTGAGGAGGGTGAAGGTACAAA
Associated Phenotype:
Not determined