Busch Lab

ZMP

si:ch211-139k15.1

Ensembl ID:
ENSDARG00000076916
ZFIN ID:
ZDB-GENE-090312-48
Human Orthologue:
MAGI3
Human Description:
membrane associated guanylate kinase, WW and PDZ domain containing 3 [Source:HGNC Symbol;Acc:29647]
Mouse Orthologue:
Magi3
Mouse Description:
membrane associated guanylate kinase, WW and PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa39409 Nonsense Mutation detected in F1 DNA Not yet available
sa32444 Essential Splice Site Available for shipment Available now
sa37725 Essential Splice Site Available for shipment Available now
sa37724 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37723 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19325 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10154 Essential Splice Site Available for shipment Available now
sa24348 Essential Splice Site Available for shipment Available now
sa37722 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39409
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Nonsense 32 1347 1 21
ENSDART00000141091 Nonsense 32 1027 1 18
ENSDART00000144918 None None 195 None 4
Genomic Location (Zv9):
Chromosome 23 (position 26729165)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26561987
GRCz11 23 26488528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGGAATGTGCTGTTTCGTGGGGTAATGCAGAGGAGCTCTGCGCCGTGT[T/A]GGAGATACGCGGAGGAGCCGAGCACGGAGAGTTCCCGCACCTGGGACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32444
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Essential Splice Site 102 1347 1 21
ENSDART00000141091 Essential Splice Site 102 1027 1 18
ENSDART00000144918 None None 195 None 4
Genomic Location (Zv9):
Chromosome 23 (position 26728952)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26561774
GRCz11 23 26488315
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCATCCGCCACTTTCGCGAACCCCTCCGTCTGAAGACTGTCAAGCCAG[G/A]TTAGTTTGTCTGTTTGCTAATTAAAGCCTGAGTTATCTGTTTGTGACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37725
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Essential Splice Site 307 1347 6 21
ENSDART00000141091 Essential Splice Site 307 1027 6 18
ENSDART00000144918 None None 195 None 4
Genomic Location (Zv9):
Chromosome 23 (position 26535605)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26368427
GRCz11 23 26294968
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGTGTTTACTTGCTAACTTTCCCTCCCTTTCTTTCCCTCTCCATCTA[G/A]TCACAACTCCAAGACCACGACCTGGCTCGACCCACGACTGGCAAAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37724
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Essential Splice Site 333 1347 6 21
ENSDART00000141091 Essential Splice Site 333 1027 6 18
ENSDART00000144918 None None 195 None 4
Genomic Location (Zv9):
Chromosome 23 (position 26535524)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26368346
GRCz11 23 26294887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCACGACTGGCAAAGAAAGCAAAGCCTCCTGAAAAATGTGAAGATGGAG[G/A]TAAGACTGAATCACACACACAACATAAACAGACCCTTAGCTGAAAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37723
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Essential Splice Site 653 1347 10 21
ENSDART00000141091 Essential Splice Site 653 1027 10 18
ENSDART00000144918 None None 195 None 4
Genomic Location (Zv9):
Chromosome 23 (position 26506571)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26339393
GRCz11 23 26265934
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAGACCTGCCGGTGGGCAGCGAGGTCAACGTGCTGGTGCTCAGAGGAG[G/A]TGAGGCAAAGAGGGTTATATGGGTATCAGTGCTCATTTTGACTGCAAACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5050
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Essential Splice Site 728 1347 12 21
ENSDART00000141091 Essential Splice Site 728 1027 12 18
ENSDART00000144918 None None 195 None 4
Genomic Location (Zv9):
Chromosome 23 (position 26498598)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26331420
GRCz11 23 26257961
KASP Assay ID:
554-3601.1 (used for ordering genotyping assays)
KASP Sequence:
GGACCCAACAGAGCTCTACCTCAAGTCCAAAGCAATGCAGGACAGCAAAC[G/A]TGAGWTCTGCCTCAATGCTTACGAATGATCTGCTTACTTCACTATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19325
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Essential Splice Site 1019 1347 18 21
ENSDART00000141091 None 1027 1027 18 18
ENSDART00000144918 None 195 195 4 4
ENSDART00000113660 Essential Splice Site 1019 1347 18 21
ENSDART00000141091 None 1027 1027 18 18
ENSDART00000144918 None 195 195 4 4
Genomic Location (Zv9):
Chromosome 23 (position 26485801)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26318623
GRCz11 23 26245164
KASP Assay ID:
554-6192.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTTCCTCAGGGGGAAATGGGGACTGTCATCACCTCAGGAATAAAGCAG[G/A]TGAGACGTGATACGCTTGCGGTAATAGAGCACACAGATTATTATTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10154
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Essential Splice Site 1019 1347 18 21
ENSDART00000141091 None 1027 1027 18 18
ENSDART00000144918 None 195 195 4 4
ENSDART00000113660 Essential Splice Site 1019 1347 18 21
ENSDART00000141091 None 1027 1027 18 18
ENSDART00000144918 None 195 195 4 4
Genomic Location (Zv9):
Chromosome 23 (position 26485801)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26318623
GRCz11 23 26245164
KASP Assay ID:
554-6192.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTTCCTCAGGGGGAAATGGGGACTGTCATCACCTCAGGAATAAAGCAG[G/A]TGAGACGTGATACGCTTGCSGTAATAGAGCACACAGATTATTATTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24348
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Essential Splice Site 1020 1347 19 21
ENSDART00000141091 None None 1027 None 18
ENSDART00000144918 None None 195 None 4
Genomic Location (Zv9):
Chromosome 23 (position 26481605)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26314798
GRCz11 23 26241339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAAACAAACTTCTCTGTCTGTCTGTGTGCATGTGTGTCTGTGGTTTTT[A/G]GGGCTGTTATCCAGTGGAGTTGGAAAGAGGACAGAGAGGCTTTGGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37722
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113660 Nonsense 1332 1347 21 21
ENSDART00000141091 None None 1027 None 18
ENSDART00000144918 None None 195 None 4
Genomic Location (Zv9):
Chromosome 23 (position 26472538)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26305693
GRCz11 23 26232234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGGTGGCAACCCTTCGGCCAAGAAAGCCCCCATAACTCCAGGTCCCT[G/A]GAAAGTCCCAAGCTCCACCAGGGTTCAGCCTCCGGTGCATGGAGTCTGAT
Associated Phenotype:
Not determined