Busch Lab

ZMP

frem2a

Ensembl ID:
ENSDARG00000076856
ZFIN ID:
ZDB-GENE-081119-3
Description:
Fras1 related extracellular matrix protein 2a [Source:RefSeq peptide;Acc:NP_001131129]
Human Orthologue:
FREM2
Human Description:
FRAS1 related extracellular matrix protein 2 [Source:HGNC Symbol;Acc:25396]
Mouse Orthologue:
Frem2
Mouse Description:
Fras1 related extracellular matrix protein 2 Gene [Source:MGI Symbol;Acc:MGI:2444465]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa16135 Nonsense Available for shipment Available now
sa17334 Essential Splice Site Available for shipment Available now
sa24874 Nonsense Mutation detected in F1 DNA Not yet available
sa41667 Nonsense Mutation detected in F1 DNA Not yet available
sa21742 Nonsense Available for shipment Available now
sa14672 Nonsense Available for shipment Available now
sa2557 Nonsense F2 line generated Not yet available
sa5585 Nonsense F2 line generated Not yet available
sa21743 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16135
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 1112 3119 1 25
ENSDART00000128292 Nonsense 1112 3113 1 25
ENSDART00000143255 None None 1427 None 23
Genomic Location (Zv9):
Chromosome 10 (position 26620264)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26024121
GRCz11 10 25985834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGACAGGTTMACGTTCAGATGTTCKGAWGGTGTRAATTTCTCAGAGAGA[C/T]AGTTCTTTCCCATTGTCATTATYCCCACAAATGATGAAAAACCAGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17334
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Essential Splice Site 1748 3119 None 25
ENSDART00000128292 Essential Splice Site 1748 3113 None 25
ENSDART00000143255 Essential Splice Site 56 1427 None 23
Genomic Location (Zv9):
Chromosome 10 (position 26653965)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26057822
GRCz11 10 26019535
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGTGACCCTCAGACGGAGAGGTTTCCTGGGTGAAACGTCTTTTGTTGG[T/C]GAGTATCTTTATATGCAATTTAGCTTTGCCTGCATTTTCCACTCATTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24874
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 1793 3119 4 25
ENSDART00000128292 Nonsense 1793 3113 4 25
ENSDART00000143255 Nonsense 101 1427 2 23
Genomic Location (Zv9):
Chromosome 10 (position 26660005)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26063862
GRCz11 10 26025575
KASP Assay ID:
554-7368.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACCACAGCCTCCTGGAAAGTCAGAGTTCTCTCGGATGGGAAATACGAG[C/T]AGTCCGAAACGTTTCAAATTGTGCTGACTGAGCCGGTGATGGGCGTTTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27617
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Essential Splice Site 1825 3119 4 25
ENSDART00000128292 Essential Splice Site 1825 3113 4 25
ENSDART00000143255 Essential Splice Site 133 1427 2 23
Genomic Location (Zv9):
Chromosome 10 (position 26660103)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26063960
GRCz11 10 26025673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGAGGCGCCAGCTGTAGCCACAGTTGAGATTGTGGATCCAGGTGATGG[T/C]AAGTCCAACAGATGTTCACAAATCAGTTGTTTGCACACAAACATGCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41667
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 1915 3119 6 25
ENSDART00000128292 Nonsense 1915 3113 6 25
ENSDART00000143255 Nonsense 223 1427 4 23
Genomic Location (Zv9):
Chromosome 10 (position 26672184)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26076041
GRCz11 10 26037754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGAGACGGAAAAACACTGTCGTGTGGTGATCATCGATGACTCTCTGTA[T/A]GAGAGCGAGGAGAGCTTCAACGTGACCCTCAGCATGCCTATAGGAGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21742
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2663 3119 17 25
ENSDART00000128292 Nonsense 2663 3113 17 25
ENSDART00000143255 Nonsense 971 1427 15 23
Genomic Location (Zv9):
Chromosome 10 (position 26733166)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26137023
GRCz11 10 26098736
KASP Assay ID:
2260-3297.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACCTTTGTTTATGACACTGCCATCTTGTGGAAGGACGGAGTCGGCAGC[C/T]AAACACAGGCTGATCTACAAGGCAAGTCATGAGTTTCAGAAACAAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14672
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
Genomic Location (Zv9):
Chromosome 10 (position 26742243)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26146100
GRCz11 10 26107813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTACTGTAACATTGAGAAGGTGTATCTGTGCACTGGAGCTGATGGATA[T/A]GTTCCTAAATACAACCCCAGCAAGTCTGAGTTTGGATGCCTTGCTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2557
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
Genomic Location (Zv9):
Chromosome 10 (position 26742243)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26146100
GRCz11 10 26107813
KASP Assay ID:
554-3067.1 (used for ordering genotyping assays)
KASP Sequence:
TTCTACTGTAACATTGAGAAGGTGTATCTGTGCACTGGAGCTGATGGATA[T/A]GTTCCTAAATACAACCCCAGCAAGTCTGAGTTTGGATGCCTTGCTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5585
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
Genomic Location (Zv9):
Chromosome 10 (position 26742243)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26146100
GRCz11 10 26107813
KASP Assay ID:
554-3067.1 (used for ordering genotyping assays)
KASP Sequence:
TTCTACTGTAACATTGAGAAGGTGTATCTGTGCACTGGAGCTGATGGATA[T/A]GTTCCTAAATACAACCCCAGCAAGTCTGAGTTTGGATGCCTTGCTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21743
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2890 3119 23 25
ENSDART00000128292 Nonsense 2884 3113 23 25
ENSDART00000143255 Nonsense 1198 1427 21 23
Genomic Location (Zv9):
Chromosome 10 (position 26742277)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26146134
GRCz11 10 26107847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAGCTGATGGATATGTTCCTAAATACAACCCCAGCAAGTCTGAGTTT[G/T]GATGCCTTGCTGACTCTCCGTCTCTGCTCTACCAATTCAAGATTATTGTA
Associated Phenotype:
Not determined