Busch Lab

ZMP

NP_001122252.1

Ensembl ID:
ENSDARG00000076831
Description:
hypothetical protein LOC793880 [Source:RefSeq peptide;Acc:NP_001122252]
Human Orthologue:
IQCK
Human Description:
IQ motif containing K [Source:HGNC Symbol;Acc:28556]
Mouse Orthologue:
Iqck
Mouse Description:
IQ motif containing K Gene [Source:MGI Symbol;Acc:MGI:3612188]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa31367 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31367
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112428 Nonsense 191 225 8 8
Genomic Location (Zv9):
Chromosome 3 (position 63022777)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62123882
GRCz11 3 62360512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGATGCGCTGGTGGACGGCGCGGATCCGCATGTGGAGGCTGGAGTGTA[T/G]ATTGAGGTTGTGCCGCCGACGCCGCAGAACAGAGCGCTTTACACACCGAC
Associated Phenotype:
Not determined