Busch Lab

ZMP

si:dkey-65b12.6

Ensembl ID:
ENSDARG00000076830
ZFIN ID:
ZDB-GENE-060526-329
Human Orthologue:
FCGBP
Human Description:
Fc fragment of IgG binding protein [Source:HGNC Symbol;Acc:13572]
Mouse Orthologues:
9530053A07Rik, Fcgbp
Mouse Descriptions:
Fc fragment of IgG binding protein Gene [Source:MGI Symbol;Acc:MGI:2444336]
RIKEN cDNA 9530053A07 gene Gene [Source:MGI Symbol;Acc:MGI:2442118]

Alleles

There are 21 alleles of this gene:

Allele Name Consequence Status Availability
sa40529 Nonsense Mutation detected in F1 DNA Not yet available
sa20511 Nonsense Available for shipment Available now
sa20510 Essential Splice Site Available for shipment Available now
sa18176 Nonsense Available for shipment Available now
sa8560 Nonsense Mutation detected in F1 DNA Not yet available
sa9280 Nonsense Mutation detected in F1 DNA Not yet available
sa20509 Nonsense Available for shipment Available now
sa33680 Nonsense Mutation detected in F1 DNA Not yet available
sa20508 Nonsense Available for shipment Available now
sa20507 Nonsense Available for shipment Available now
sa26544 Nonsense Mutation detected in F1 DNA Not yet available
sa44615 Nonsense Mutation detected in F1 DNA Not yet available
sa10822 Nonsense Available for shipment Available now
sa40528 Nonsense Mutation detected in F1 DNA Not yet available
sa15283 Nonsense Available for shipment Available now
sa20506 Nonsense Available for shipment Available now
sa14461 Nonsense Available for shipment Available now
sa5813 Essential Splice Site, Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa40529
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 159 4234 2 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43463198)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41244463
GRCz11 5 41844616
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAATTGGAACCTCCAGAAAAACAGTCTCTTTAGCTCCCTATCAAGTTTA[T/A]CAACTTCGCAGTGAAAAAACGTTGTCGGGAACAAAAATCACATCTGTGTC
Long Flanking Sequence:
GGGCGTGAATTCATCACAGCTTTCATGACAAATTATGAGTATGGACAAGCCAGTCTGAGTCTCACCATAACAGCACACTCCTCTCCAGCAACTGTGAAAGTTGAAATAAAGGCACTGAGTTACAGTCAGAAATTTGACATAGGACGAGGTGAGACCAAAAAAATTGTCCTCCCTTCAAATGCTGAGATTAACGATGAAGAAGTCTCCAGCAAAACAGTGTACATCTCTTCAACTGCTGACATCTCAGTCGTGTCGTCCAACTTAAAAGATTACACAGGAGACAGCAGTGTGATTTTCCCCATAAGTCAGCTTGGCAGGAGTTATGTAGCTTTTACTCCAGACACGGGTCCACCTAGATATCAAAAGCTGGTCACCATAGTCAACGGCAATTACATGAACAAAATCGAGATCACTTTCAGCTCAAAAAAAACTTTGCTTGATTCCATTTTTGGAATTGGAACCTCCAGAAAAACAGTCTCTTTAGCTCCCTATCAAGTTTA[T/A]CAACTTCGCAGTGAAAAAACGTTGTCGGGAACAAAAATCACATCTGTGTCTCCAGTGGCTGTCCTGGCAGGACACGAGTGCTCCATGATCATAGGCACCTGTGAGCACGTCTATGAGCAGCTGATCCCAGTTGAATTTCTCTCTAATGAATATCTGCTTCCTGCTATGCATCAGTCCTTAAGCATAGACACAGCTTTCGTGGTTGCCCCAGAGGACAACACTATTGTGTCCATTTTCGATAGTCGTATTTGGTTCCCCAAAAAAAGAAAATTAAATTCTGGAGAAGTTTTACCCATTGATTTAAGCAAAAATTCTAAGATCATTCAAAGTAGCAAAAATGTCATGGTAATGTATTTCAGTAGCAATTTTCCGAATGACGAGTTTCTAACCAATGTCATACCCACTTCTGAAATGTCAAAGTCATGGACCATTCACTCTCAAGATTACTATGATAACACGCTTGTTGTTGTTGCCGAAGCTGCATCAGCCTCAACTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20511
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 193 4234 2 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43463096)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41244361
GRCz11 5 41844514
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGTGGCTGTCCTGGCAGGACACGAGTGCTCCATGATCATAGGCACCTG[T/A]GAGCACGTCTATGAGCAGCTGATCCCAGTTGAATTTCTCTCTAATGAATA
Long Flanking Sequence:
GAAATAAAGGCACTGAGTTACAGTCAGAAATTTGACATAGGACGAGGTGAGACCAAAAAAATTGTCCTCCCTTCAAATGCTGAGATTAACGATGAAGAAGTCTCCAGCAAAACAGTGTACATCTCTTCAACTGCTGACATCTCAGTCGTGTCGTCCAACTTAAAAGATTACACAGGAGACAGCAGTGTGATTTTCCCCATAAGTCAGCTTGGCAGGAGTTATGTAGCTTTTACTCCAGACACGGGTCCACCTAGATATCAAAAGCTGGTCACCATAGTCAACGGCAATTACATGAACAAAATCGAGATCACTTTCAGCTCAAAAAAAACTTTGCTTGATTCCATTTTTGGAATTGGAACCTCCAGAAAAACAGTCTCTTTAGCTCCCTATCAAGTTTATCAACTTCGCAGTGAAAAAACGTTGTCGGGAACAAAAATCACATCTGTGTCTCCAGTGGCTGTCCTGGCAGGACACGAGTGCTCCATGATCATAGGCACCTG[T/A]GAGCACGTCTATGAGCAGCTGATCCCAGTTGAATTTCTCTCTAATGAATATCTGCTTCCTGCTATGCATCAGTCCTTAAGCATAGACACAGCTTTCGTGGTTGCCCCAGAGGACAACACTATTGTGTCCATTTTCGATAGTCGTATTTGGTTCCCCAAAAAAAGAAAATTAAATTCTGGAGAAGTTTTACCCATTGATTTAAGCAAAAATTCTAAGATCATTCAAAGTAGCAAAAATGTCATGGTAATGTATTTCAGTAGCAATTTTCCGAATGACGAGTTTCTAACCAATGTCATACCCACTTCTGAAATGTCAAAGTCATGGACCATTCACTCTCAAGATTACTATGATAACACGCTTGTTGTTGTTGCCGAAGCTGCATCAGCCTCAACTATTAGTGGCTCAATGAAGTGGAAAACATTCCCTGCAAACAATAAGTTTGTATGGGCTACCAAGTCAATTGGTTCGCAGAGAGGTCCCATCACCATTTCTGGTGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20510
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Essential Splice Site 383 4234 2 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43462524)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41243789
GRCz11 5 41843942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGGAAAAATAAGGCATGGATATGCCACAACAGGAGTGTGTAACACTG[G/A]TGAGTCATTTGAACATTCTTGGTTTAGGCAATCAGTCAGAAATAACCTAT
Long Flanking Sequence:
GTCCTTAAGCATAGACACAGCTTTCGTGGTTGCCCCAGAGGACAACACTATTGTGTCCATTTTCGATAGTCGTATTTGGTTCCCCAAAAAAAGAAAATTAAATTCTGGAGAAGTTTTACCCATTGATTTAAGCAAAAATTCTAAGATCATTCAAAGTAGCAAAAATGTCATGGTAATGTATTTCAGTAGCAATTTTCCGAATGACGAGTTTCTAACCAATGTCATACCCACTTCTGAAATGTCAAAGTCATGGACCATTCACTCTCAAGATTACTATGATAACACGCTTGTTGTTGTTGCCGAAGCTGCATCAGCCTCAACTATTAGTGGCTCAATGAAGTGGAAAACATTCCCTGCAAACAATAAGTTTGTATGGGCTACCAAGTCAATTGGTTCGCAGAGAGGTCCCATCACCATTTCTGGTGATTCGCCCATGGCTGCTTATGCTTTTGGTGGAAAAATAAGGCATGGATATGCCACAACAGGAGTGTGTAACACTG[G/A]TGAGTCATTTGAACATTCTTGGTTTAGGCAATCAGTCAGAAATAACCTATGAATTGTAACTGATTGAAATGTTAAACAAATAAACTTTCCTGTGTTTCCTAAGCCATAACAACAACGCCGCCTCCACCAGACCCCTGTGAGACAATGAAGTGTCGTCAGCAGGAGGAGTGCAGGAAGGGTGTCTGTGTTGCCACTTCCACTGCTACTTGCCATGCAGTTGGCGATCCCCATTTCAAAACCTTTGATGGGAAACTATTTGACTTTCAGGGAACTTGCACATATGTCATGGTCAACAGTACAAAGACTCAAAAAGGCCTCATACCCTTCAGTATCTTGACGAAGAATAATCACCGGGGAAGCACACGGGTGGCGTATGTGAGGTCGGTTTCTGTGCTTGTGTACACTCACACAATTGTGGTTGGCAGCCAGAAAGGAGTAGTAGAGGTAAAAATGAATGAAAAGCACTTCTAGTTTCTTGATAGATTTATAATCAGTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18176
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 501 4234 4 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43461963)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41243228
GRCz11 5 41843381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTCTTTTTTTGGACTCTGTATTCTTGTTTCTCTGTCTAGTTTGATGGT[G/T]AAAACACTTACCTGCCTTTGARTATAGATGGTGGAAAAATAAAGGTGAAW
Long Flanking Sequence:
TGATTGAAATGTTAAACAAATAAACTTTCCTGTGTTTCCTAAGCCATAACAACAACGCCGCCTCCACCAGACCCCTGTGAGACAATGAAGTGTCGTCAGCAGGAGGAGTGCAGGAAGGGTGTCTGTGTTGCCACTTCCACTGCTACTTGCCATGCAGTTGGCGATCCCCATTTCAAAACCTTTGATGGGAAACTATTTGACTTTCAGGGAACTTGCACATATGTCATGGTCAACAGTACAAAGACTCAAAAAGGCCTCATACCCTTCAGTATCTTGACGAAGAATAATCACCGGGGAAGCACACGGGTGGCGTATGTGAGGTCGGTTTCTGTGCTTGTGTACACTCACACAATTGTGGTTGGCAGCCAGAAAGGAGTAGTAGAGGTAAAAATGAATGAAAAGCACTTCTAGTTTCTTGATAGATTTATAATCAGTGTGAATGATAACTAAATCTCTTTTTTTGGACTCTGTATTCTTGTTTCTCTGTCTAGTTTGATGGT[G/T]AAAACACTTACCTGCCTTTGAGTATAGATGGTGGAAAAATAAAGGTGAATCAGAGAGGGCTGAATGTTATAATATCGACAGATTTTGGCTTAGAGGTGAAATATGACTGGAATATGATGTTGTACATCACCGCTCCAAGTAGCTATTTCCAGACTGTAGGTGGTCTTTGTGGAAACTATAATGGTGACAGACGAGATGAATATATCGATCCTAAAGGCAACACACTCTCCAGTATCATTGACTTTGCAAAAACCTGGAAGGTTCCAGATAATGATCTGTTTTGCAATGATGACTGTAATGGACAATGCCCAAGTTGCACTGTAAGTCTTCAGGAAGAGTACAAAAAAGAGTCAAACTGTGGTGTCATAGCCAAATCCGATGGGCCATTTGTTTTGTGCCACAACACTGTGGATCCGCGCATGTATGTAGATAATTGTGTATATGATGTCTGCATTAACAATGGGATCAGAAACTTCCTCTGCAACAACATTCAAAGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8560
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 542 4234 4 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43461838)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41243103
GRCz11 5 41843256
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGACAGATTTTGGCTTAGAGGTGAAATATGACTGGAATATGATGTTGTA[C/A]ATCACCGCTCCAAGTAGCTAWTTCCAGACTGTAGGTGGTCTTTGTGGAAA
Long Flanking Sequence:
TGTTGCCACTTCCACTGCTACTTGCCATGCAGTTGGCGATCCCCATTTCAAAACCTTTGATGGGAAACTATTTGACTTTCAGGGAACTTGCACATATGTCATGGTCAACAGTACAAAGACTCAAAAAGGCCTCATACCCTTCAGTATCTTGACGAAGAATAATCACCGGGGAAGCACACGGGTGGCGTATGTGAGGTCGGTTTCTGTGCTTGTGTACACTCACACAATTGTGGTTGGCAGCCAGAAAGGAGTAGTAGAGGTAAAAATGAATGAAAAGCACTTCTAGTTTCTTGATAGATTTATAATCAGTGTGAATGATAACTAAATCTCTTTTTTTGGACTCTGTATTCTTGTTTCTCTGTCTAGTTTGATGGTGAAAACACTTACCTGCCTTTGAGTATAGATGGTGGAAAAATAAAGGTGAATCAGAGAGGGCTGAATGTTATAATATCGACAGATTTTGGCTTAGAGGTGAAATATGACTGGAATATGATGTTGTA[C/A]ATCACCGCTCCAAGTAGCTATTTCCAGACTGTAGGTGGTCTTTGTGGAAACTATAATGGTGACAGACGAGATGAATATATCGATCCTAAAGGCAACACACTCTCCAGTATCATTGACTTTGCAAAAACCTGGAAGGTTCCAGATAATGATCTGTTTTGCAATGATGACTGTAATGGACAATGCCCAAGTTGCACTGTAAGTCTTCAGGAAGAGTACAAAAAAGAGTCAAACTGTGGTGTCATAGCCAAATCCGATGGGCCATTTGTTTTGTGCCACAACACTGTGGATCCGCGCATGTATGTAGATAATTGTGTATATGATGTCTGCATTAACAATGGGATCAGAAACTTCCTCTGCAACAACATTCAAAGCTACGTTGATGCTTGTATGTCAGCTGGAATTAAGATCACTGGAAACTGGAGGACACTTGCGAACTGTCGTAAGTGTACACATATATTCAATACAATCAATATTGTTTATTTTTAAATATAAGCATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9280
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 549 4234 4 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43461817)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41243082
GRCz11 5 41843235
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGAAATATGACTGGAATATGATGTTGTAMATCACCGCTCCAAGTAGCTA[T/A]TTCCAGACTGTAGGTGGTCTTTGTGGAAACTATAATGGTGACAGACGAGA
Long Flanking Sequence:
TTGCCATGCAGTTGGCGATCCCCATTTCAAAACCTTTGATGGGAAACTATTTGACTTTCAGGGAACTTGCACATATGTCATGGTCAACAGTACAAAGACTCAAAAAGGCCTCATACCCTTCAGTATCTTGACGAAGAATAATCACCGGGGAAGCACACGGGTGGCGTATGTGAGGTCGGTTTCTGTGCTTGTGTACACTCACACAATTGTGGTTGGCAGCCAGAAAGGAGTAGTAGAGGTAAAAATGAATGAAAAGCACTTCTAGTTTCTTGATAGATTTATAATCAGTGTGAATGATAACTAAATCTCTTTTTTTGGACTCTGTATTCTTGTTTCTCTGTCTAGTTTGATGGTGAAAACACTTACCTGCCTTTGAGTATAGATGGTGGAAAAATAAAGGTGAATCAGAGAGGGCTGAATGTTATAATATCGACAGATTTTGGCTTAGAGGTGAAATATGACTGGAATATGATGTTGTACATCACCGCTCCAAGTAGCTA[T/A]TTCCAGACTGTAGGTGGTCTTTGTGGAAACTATAATGGTGACAGACGAGATGAATATATCGATCCTAAAGGCAACACACTCTCCAGTATCATTGACTTTGCAAAAACCTGGAAGGTTCCAGATAATGATCTGTTTTGCAATGATGACTGTAATGGACAATGCCCAAGTTGCACTGTAAGTCTTCAGGAAGAGTACAAAAAAGAGTCAAACTGTGGTGTCATAGCCAAATCCGATGGGCCATTTGTTTTGTGCCACAACACTGTGGATCCGCGCATGTATGTAGATAATTGTGTATATGATGTCTGCATTAACAATGGGATCAGAAACTTCCTCTGCAACAACATTCAAAGCTACGTTGATGCTTGTATGTCAGCTGGAATTAAGATCACTGGAAACTGGAGGACACTTGCGAACTGTCGTAAGTGTACACATATATTCAATACAATCAATATTGTTTATTTTTAAATATAAGCATACATTTATTTTGTTTACTTGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20509
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 823 4234 5 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43460839)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41242104
GRCz11 5 41842257
KASP Assay ID:
2259-6351.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGTACCTGCCAGGCTGCAGGAGATCCACACTTCCGCACATTTGATGGC[A/T]AGGCATTTGACTTCCAAGGAACCTGCACATATTATTTGTCCAAACTACTG
Long Flanking Sequence:
ATTTATTTTGTTTACTTGAATTGTTTTTGCCTTTATGCTGGCATTTGAAGAGACAATGTTTGTGCCGTATAATAATTATTTGCATTCTTCTCCTCCAAGCACTGAGCTGTCCAGTCAACATGCATTATGAATTCTGTGGCACAGCCTGTGCTGCATCTTGTGCTGATCGTAGTGCCCCAGACAAATGTACACTGCCATGTGTGGAGGGCTGTCACTGTAATACAGGTTTTGTCCGGAGTGGAGCTGAATGTGTACCTATGAATAAGTGTGGCTGCACATACAAAGGCCGATATTATCTTGCTGAGCAGTCTTTTTGGAGTGATGCAAAATGCACAGAGAAATGTGTGTGCAACTCTCAAACTGGAAATGTTGAATGCACACCAACAAAGTGCAAGAAGTCTCAGATGTGTGACACACGGAATGGAGTGAAAGACTGTTATCCATTGTCATATAGTACCTGCCAGGCTGCAGGAGATCCACACTTCCGCACATTTGATGGC[A/T]AGGCATTTGACTTCCAAGGAACCTGCACATATTATTTGTCCAAACTACTGAACACAGCTGACCCGACACTGATACCCTTTGAAGTATTGGTCAAGAATGAGAACAGAGGAAGGAACTTGGCAGTTGCTTACACTAAGACTGTGTCCTTAAAAGTTTATAACTACACTATTGTCTTAAGTAAGGATGACCCATTCACAGTGAAGGTCAGTACATTCAATAAGTCTAATGCACATTAATATGATTGACTGCATGTAGGCATGAAATGTCAATTATACACTGACTAACAATACTTCGAAAAACATTTTTTGTCCTAAAGGTCAACAATCTGTTTGTGAATTTGCCATTTGAGCAAAAGGATGGTCTCTTCTCAATATTCCGCAGCGGGTATTTTGGTGTTGTGAAAACTGACTTTGATTTGACTATGAAATTCAATTGGGACAGCCACGTAGCATTGACTCTCCCCAGCACTTACTACGGTGTCGTGGGAGGGCTTTGCGGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26545
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 1091 4234 7 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 Nonsense 113 602 2 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43459837)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41241102
GRCz11 5 41841255
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATAACATTGATTTTCCACAGCTGCATCTTGTATGGACAACAGTCACTAT[G/T]AGGTTTGTGCAGCAGGGTGTTCACAGACCTGCCACGGCCTCACAGAACCT
Long Flanking Sequence:
CTGGAACGACAATATCAATGATGATTTTCTTACTCCTGACAAAACCCTTGGTGCAACTGCATCAATTTTTGGAACCAGCTGGAAAGTCCAGGATGATCCTGGATGTTCAGATGCATGTCAGGGAAAAGCATGTCCTAAATGTGATGTTGCAGAGAGAAATAAAGACACTTTTACAAAGCCTTGCAGCAAGATCACTGACAAACAGGGACCTTTTAAAGGCTGCCACAGTAAAGTGAATCCAAATCAGTTTTATGAGGATTGTGTGTATGATATGTGCATGTACGGTGGCCATTCAACAGCCCTCTGTAGTGCTCTTACTGCATACACAGCTGCTTGCCAACATGCGCTTGGTGCCGTGGAGTCCTGGAGAACTGACAGCTTTTGCCGTTAGTATTCCTTCCACTTTGTCTTTTAGATTTTGCCAAAGTTGATGAAAAAATTAATGACACTTATAACATTGATTTTCCACAGCTGCATCTTGTATGGACAACAGTCACTAT[G/T]AGGTTTGTGCAGCAGGGTGTTCACAGACCTGCCACGGCCTCACAGAACCTAAGGCCTGTGTGGGGACTTCTTGCGTTGAAAGCTGTATATGTGATGAGGGCTTTGTCCTGAGCGATGGTGTCTGTGTATCTATGGAACAGTGTGGCTGTTCATATGAGGGCCTTTACTATAAAATGGGCCAAGTGTTCTTCCCTCAAGACAAGTGTCTCCAGAGATGCACCTGCAAAGAAAATGGAAAAGTTCAGTGTGATGATGGGTTCACCTGCAAACCCAACGAAAAGTGCCAAGTCCTGAATGGAGTACAGGGCTGTTTCCCAGATGGCAAAGCAGTTTGTTCAGTATCAGGATTTGGGTTCTATCAATCATTTGATGGAAGGTCCTTTAGCGTTCAAGGAGACTGTGAGTACAGATTGGTTGAAACAGCTCTGGACAGCGATGATGACTTGAGCTTTTTTAGTGTCTTAATAAAACAACAGTCCTCTGAGATGGTCTTCACTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33680
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 1202 4234 7 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 Nonsense 224 602 2 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43459502)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41240767
GRCz11 5 41840920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTCCTGAATGGAGTACAGGGCTGTTTCCCAGATGGCAAAGCAGTTTG[T/A]TCAGTATCAGGATTTGGGTTCTATCAATCATTTGATGGAAGGTCCTTTAG
Long Flanking Sequence:
GCCAACATGCGCTTGGTGCCGTGGAGTCCTGGAGAACTGACAGCTTTTGCCGTTAGTATTCCTTCCACTTTGTCTTTTAGATTTTGCCAAAGTTGATGAAAAAATTAATGACACTTATAACATTGATTTTCCACAGCTGCATCTTGTATGGACAACAGTCACTATGAGGTTTGTGCAGCAGGGTGTTCACAGACCTGCCACGGCCTCACAGAACCTAAGGCCTGTGTGGGGACTTCTTGCGTTGAAAGCTGTATATGTGATGAGGGCTTTGTCCTGAGCGATGGTGTCTGTGTATCTATGGAACAGTGTGGCTGTTCATATGAGGGCCTTTACTATAAAATGGGCCAAGTGTTCTTCCCTCAAGACAAGTGTCTCCAGAGATGCACCTGCAAAGAAAATGGAAAAGTTCAGTGTGATGATGGGTTCACCTGCAAACCCAACGAAAAGTGCCAAGTCCTGAATGGAGTACAGGGCTGTTTCCCAGATGGCAAAGCAGTTTG[T/A]TCAGTATCAGGATTTGGGTTCTATCAATCATTTGATGGAAGGTCCTTTAGCGTTCAAGGAGACTGTGAGTACAGATTGGTTGAAACAGCTCTGGACAGCGATGATGACTTGAGCTTTTTTAGTGTCTTAATAAAACAACAGTCCTCTGAGATGGTCTTCACTCGAAGAGTTGAATTACAAATAGAAGAATCCACAATTACTTTGCTGCCCGGTCACATCTGGGAGGTTCAGGTAATGTTCTAGTTACTGAAACACACAAAGAAGTTTTTAGACCTTTATTACGGTTACCTAAAGCGTTTTGTTGGTGTTATATTTGCAGGTTGGCAAAGTTAAAACCAATCTTCCTGTCACTGTGGGTGAAGGACTTATACAAGTCTATCAGAGCGGTATTAACATTGTTGTGGAAACAGACTTTGGATTGAAACTGACATATGATACAGTCTCCGTGGCCAGAATTGAGATCCCGTCCACTTTTAAAAATGCAGTCAGAGGTCTCTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5746
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Essential Splice Site 1279 4234 7 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 Essential Splice Site 301 602 2 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43459269)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41240534
GRCz11 5 41840687
KASP Assay ID:
554-3611.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAGAATCCACAATTACTTTGCTGCCCGGTCACATCTGGGAGGTTCAGG[T/C]AATGTTCTAGTTACTGAAACACACAAAGAAGTTTTTAGACCTTTATTACG
Long Flanking Sequence:
TTCTTGCGTTGAAAGCTGTATATGTGATGAGGGCTTTGTCCTGAGCGATGGTGTCTGTGTATCTATGGAACAGTGTGGCTGTTCATATGAGGGCCTTTACTATAAAATGGGCCAAGTGTTCTTCCCTCAAGACAAGTGTCTCCAGAGATGCACCTGCAAAGAAAATGGAAAAGTTCAGTGTGATGATGGGTTCACCTGCAAACCCAACGAAAAGTGCCAAGTCCTGAATGGAGTACAGGGCTGTTTCCCAGATGGCAAAGCAGTTTGTTCAGTATCAGGATTTGGGTTCTATCAATCATTTGATGGAAGGTCCTTTAGCGTTCAAGGAGACTGTGAGTACAGATTGGTTGAAACAGCTCTGGACAGCGATGATGACTTGAGCTTTTTTAGTGTCTTAATAAAACAACAGTCCTCTGAGATGGTCTTCACTCGAAGAGTTGAATTACAAATAGAAGAATCCACAATTACTTTGCTGCCCGGTCACATCTGGGAGGTTCAGG[T/C]AATGTTCTAGTTACTGAAACACACAAAGAAGTTTTTAGACCTTTATTACGGTTACCTAAAGCGTTTTGTTGGTGTTATATTTGCAGGTTGGCAAAGTTAAAACCAATCTTCCTGTCACTGTGGGTGAAGGACTTATACAAGTCTATCAGAGCGGTATTAACATTGTTGTGGAAACAGACTTTGGATTGAAACTGACATATGATACAGTCTCCGTGGCCAGAATTGAGATCCCGTCCACTTTTAAAAATGCAGTCAGAGGTCTCTGTGGAAACTACAATGGAAACAGTGCAGATGATTTTCTCCTTCCAGGTGGTATTCAGGCATCTTCTGAGGTAGATTTTGTTGAAGCCTGGGTTTCAGCATCAGATAAAATGATGTGCCAAACAGGCTGTGGGGCTAACTGTTTAAAGCCTGACAAAGACAAACAGACCACAGCAGAGACCGCTTGCAGCTTGTTAATCACAGAGAAGGGACCGTTTTCTAGTTGTTATGATAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20508
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 1495 4234 9 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 Nonsense 517 602 4 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43458383)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41239648
GRCz11 5 41839801
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTACCGACACCTGTTCATCTACCTGTGCAAGCCTGACAAAGTCACAG[A/T]GATGCCCGTTGTGTCAGGAAGGTTGTCAGTGTGACGATGGTTTCTTGTTT
Long Flanking Sequence:
AGGCTGTGGGGCTAACTGTTTAAAGCCTGACAAAGACAAACAGACCACAGCAGAGACCGCTTGCAGCTTGTTAATCACAGAGAAGGGACCGTTTTCTAGTTGTTATGATAAAATTCCACCACAGAAATATTTTGATGATTGTGTCAAAGATGTGGCACAAGCAACAGACAAGACAGCTCATTGTCGCCACATACAAAACTACGTTGCCAGCTGTCAAACGATTGGGATATCAATCAACATTTGGAGGAACATAACCTTCTGTCGTAAGTTGTCGCATCCTTCAGGTTTATTAATAATTCTCTTCAAGCTTCTCTATATGCCACTACTTAGGTCTGCTGATGGAGTTTTGGAAAAGTAAACATTCTACTTTAAACTGAACCCAAATCATTTTGTTAAAATTGCTTTGTTTTCTTCCAGCACTTACATGTTCTAAAAACAGCCACTATGAACTCTGTACCGACACCTGTTCATCTACCTGTGCAAGCCTGACAAAGTCACAG[A/T]GATGCCCGTTGTGTCAGGAAGGTTGTCAGTGTGACGATGGTTTCTTGTTTGATGGAGGTGAATGTAAGGCTTTGCAGAATTGTGGCTGTCATGTAGATGGAACATTTTACAAGGTGAGAAGCTATCCCGTCTCTTTATTTTATGTTCTTTTTAAACAAAATTTCATTTTTAATTGTTAATTTTATTATTGATGTTAATTATCTATTCTGCAGTCTGGTGAGGCAGTTATTCTGGGAGAGTGTGAAGAGACATGCACCTGCACAGCTGGAGTGTTCACCTGTGTACCCATGGAATGTAAAGAGGAGGAGATATGTGGCGTAAAAAATGGTGCTATTGGATGCTACAGCAAAAGTACTTAGATTTTTAATAAATAGACCTTAAAATCAAAAGATAATTTTGTATGCAAGTTATCTCAATTTTCTTTCTTTTTGTTGTTTAATCATTCAAGCAATATACTGTCCAGTCAACATGCACTATGAGGCCTGCGGCACAGCCTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20507
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 1500 4234 9 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 Nonsense 522 602 4 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43458368)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41239633
GRCz11 5 41839786
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCATCTACCTGTGCAAGCCTGACAAAGTCACAGAGATGCCCGTTGTGT[C/T]AGGAAGGTTGTCAGTGTGACGATGGTTTCTTGTTTGATGGAGGTGAATGT
Long Flanking Sequence:
CTGTTTAAAGCCTGACAAAGACAAACAGACCACAGCAGAGACCGCTTGCAGCTTGTTAATCACAGAGAAGGGACCGTTTTCTAGTTGTTATGATAAAATTCCACCACAGAAATATTTTGATGATTGTGTCAAAGATGTGGCACAAGCAACAGACAAGACAGCTCATTGTCGCCACATACAAAACTACGTTGCCAGCTGTCAAACGATTGGGATATCAATCAACATTTGGAGGAACATAACCTTCTGTCGTAAGTTGTCGCATCCTTCAGGTTTATTAATAATTCTCTTCAAGCTTCTCTATATGCCACTACTTAGGTCTGCTGATGGAGTTTTGGAAAAGTAAACATTCTACTTTAAACTGAACCCAAATCATTTTGTTAAAATTGCTTTGTTTTCTTCCAGCACTTACATGTTCTAAAAACAGCCACTATGAACTCTGTACCGACACCTGTTCATCTACCTGTGCAAGCCTGACAAAGTCACAGAGATGCCCGTTGTGT[C/T]AGGAAGGTTGTCAGTGTGACGATGGTTTCTTGTTTGATGGAGGTGAATGTAAGGCTTTGCAGAATTGTGGCTGTCATGTAGATGGAACATTTTACAAGGTGAGAAGCTATCCCGTCTCTTTATTTTATGTTCTTTTTAAACAAAATTTCATTTTTAATTGTTAATTTTATTATTGATGTTAATTATCTATTCTGCAGTCTGGTGAGGCAGTTATTCTGGGAGAGTGTGAAGAGACATGCACCTGCACAGCTGGAGTGTTCACCTGTGTACCCATGGAATGTAAAGAGGAGGAGATATGTGGCGTAAAAAATGGTGCTATTGGATGCTACAGCAAAAGTACTTAGATTTTTAATAAATAGACCTTAAAATCAAAAGATAATTTTGTATGCAAGTTATCTCAATTTTCTTTCTTTTTGTTGTTTAATCATTCAAGCAATATACTGTCCAGTCAACATGCACTATGAGGCCTGCGGCACAGCCTGTGCTCCCACTTGTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26544
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 1520 4234 9 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 Nonsense 542 602 4 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43458308)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41239573
GRCz11 5 41839726
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGTGTGACGATGGTTTCTTGTTTGATGGAGGTGAATGTAAGGCTTTG[C/T]AGAATTGTGGCTGTCATGTAGATGGAACATTTTACAAGGTGAGAAGCTAT
Long Flanking Sequence:
CACAGAGAAGGGACCGTTTTCTAGTTGTTATGATAAAATTCCACCACAGAAATATTTTGATGATTGTGTCAAAGATGTGGCACAAGCAACAGACAAGACAGCTCATTGTCGCCACATACAAAACTACGTTGCCAGCTGTCAAACGATTGGGATATCAATCAACATTTGGAGGAACATAACCTTCTGTCGTAAGTTGTCGCATCCTTCAGGTTTATTAATAATTCTCTTCAAGCTTCTCTATATGCCACTACTTAGGTCTGCTGATGGAGTTTTGGAAAAGTAAACATTCTACTTTAAACTGAACCCAAATCATTTTGTTAAAATTGCTTTGTTTTCTTCCAGCACTTACATGTTCTAAAAACAGCCACTATGAACTCTGTACCGACACCTGTTCATCTACCTGTGCAAGCCTGACAAAGTCACAGAGATGCCCGTTGTGTCAGGAAGGTTGTCAGTGTGACGATGGTTTCTTGTTTGATGGAGGTGAATGTAAGGCTTTG[C/T]AGAATTGTGGCTGTCATGTAGATGGAACATTTTACAAGGTGAGAAGCTATCCCGTCTCTTTATTTTATGTTCTTTTTAAACAAAATTTCATTTTTAATTGTTAATTTTATTATTGATGTTAATTATCTATTCTGCAGTCTGGTGAGGCAGTTATTCTGGGAGAGTGTGAAGAGACATGCACCTGCACAGCTGGAGTGTTCACCTGTGTACCCATGGAATGTAAAGAGGAGGAGATATGTGGCGTAAAAAATGGTGCTATTGGATGCTACAGCAAAAGTACTTAGATTTTTAATAAATAGACCTTAAAATCAAAAGATAATTTTGTATGCAAGTTATCTCAATTTTCTTTCTTTTTGTTGTTTAATCATTCAAGCAATATACTGTCCAGTCAACATGCACTATGAGGCCTGCGGCACAGCCTGTGCTCCCACTTGTGCTGATCGAAATCCAGCAGAGTGTGCACTGCCATGTGTGGAGGGCTGCCAGTGCAATGCGGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44615
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 1660 4234 11 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43457431)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41238696
GRCz11 5 41838849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTGACCCGACACTGATACCCTTTGAAGTATTGGTCAAGAATGAGAAC[A/T]GAGGAAGGAACTTGGCAGTTGCTTACACTAAGAGTGTATCATTAACAGTT
Long Flanking Sequence:
TATACTGTCCAGTCAACATGCACTATGAGGCCTGCGGCACAGCCTGTGCTCCCACTTGTGCTGATCGAAATCCAGCAGAGTGTGCACTGCCATGTGTGGAGGGCTGCCAGTGCAATGCGGGTTTTGTTCGCAGTGGCGATGAGTGCATACCTGTGAAACAGTGTGGCTGCGCTTACAAAGGTCGATATTATCTCCCTGGCCAGACATTTTGGGGTGAAAAACAATGCACAGAGAAATGTGTGTGCAACTCTCAAACAGGAAATGTTGAATGTGCACCTGCAAAGTGTATGAATTCCCTGGTGTGTGGAGTACGGAATGGAGTGAAAGATTGTTACCCATTGTCATATAGTACCTGCCAGGGTGCAGGAGATCCACACTTCCGCACATTTGATGGCAAGGCATTCGACTTCCAAGGTACCTGCACATATTATTTGTCCAAACTACTGAACACAGCTGACCCGACACTGATACCCTTTGAAGTATTGGTCAAGAATGAGAAC[A/T]GAGGAAGGAACTTGGCAGTTGCTTACACTAAGAGTGTATCATTAACAGTTTATGGGTACACAATTGTCTTAAGTAAGGAAAGCCCAGGCAAAGTGAAGGTCAGTTCATTGAAAAGACGTTTATACTCTGTCTAGTAAATTACTGCATGCACAAACTGAGATAAATGTTACTGCACACTCATCTACAAAAACATGGGTTTGTCCATTAATGAAGTGAATTTGTTTTAAAGGTCAACGATTTGTTTGTGAAATTGCCATTTGAACTGGAAGATGGTCGACTCTCAATATTCTACAGTGGGTATTTTGGCATGATAAAAACTGACTTTGGTCTGACCTTGAAATTCAATTGGGACAGCCACGTAGCATTGACTCTCCCCAGCACTTACTACGGTGTGTTGGGAGGGCTTTGCGGCAACTGGAACGACAATATCAATGACGAGTTTCTTACTCCTAACAACACTCTTGCTGCAACGGCATCCATTTTCGGAACCAGCTGGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10822
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 None None 4234 None 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 Nonsense 541 591 4 5
Genomic Location (Zv9):
Chromosome 5 (position 43454969)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41236234
GRCz11 5 41836387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCAGTGTGACGATGGTTTCTTGTTTGATGGAGGTGAATGTAAGGCTTTG[C/T]AGGATTGTGGMTGTCATGTAGATGGAACATTTTACAAGGTGAGAAGCWAT
Long Flanking Sequence:
CACAGAGAAGGGACCGTTTTCTAGTTGTTATGATAAAATTCCACCACAGAAATATTTTGATGATTGTGTCAAAGATGTGGCACAAGCAACAGACAAGACAGCTCATTGTCGCCACATACAAAACTACGTTGCCAGCTGTCAAGCGATTGGGATATCAATCATTGTTTGGAGGAACACAACCTTCTGTCGTAAGTTGTCGCATCCTTCAGGTTTATTAATAATTCTCTTCAAGCTTCTCTATATGCCACTACTTAGGTCTGCTGATGGAGTTTTGGAAAAGTAAACATTCTACTTTAAACTGAACCCAAATCATTTTGTTAAAATTGCTTTGTTTTCTTCCAGCACTGACATGTTTTAAAAACAGCCACTATGAACTCTGTACCGACACCTGTTCATCTACCTGTGCAAGCCTGACAAAGTCACAGAGATGCCCGTTGTGTCAGGAAGGTTGTCAGTGTGACGATGGTTTCTTGTTTGATGGAGGTGAATGTAAGGCTTTG[C/T]AGGATTGTGGCTGTCATGTAGATGGAACATTTTACAAGGTGAGAAGCTATCCCGTCTCTTAATTTCATGTTCTTTTTTTTTTACTTGAGGAAGCAGTGACATTTTTTAATCCTCAGTTTTAATGTTTTTTGGTTTTCATTAATCTGTTCTGCAGTCTGGTGAAGCAGTTGTTCTGGGAGAGTGTAAAGAGACATGCACCTGCACAGCTGGAGTGTTCACCTGTGTACCCATGGAATGTAAAAAAGAGGAGATTTGTGACATAAAAGAGGGTGCCGTTGGATGTTACAGCAAAAGTATTTAGATTTAGAACTATACCAAAAGAGATAAATATATGTTTTTGTGCAAGTCTTTTCATTTTGTTTCTTTTTGTTGTTAAATCCTTCAAGAAACATACTGTCCAGTCAACATGCACTATGAGGCCTGCGGCACAGCCTGTGCTCCCACTTGTGCTAATCGAGATGGTCCAGAAAAGTGTGCACTGCCATGTGTGGAGGGCTGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26543
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 2365 4234 15 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43454290)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41235555
GRCz11 5 41835708
KASP Assay ID:
2259-6343.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGCAACTCTCAAACAGGAAATGTTGAATGTGCACCTGCAAAGTG[T/A]ATGAATTCCCTGGTGTGTGGAGTACGGAATGGAGTGAAAGATTGTTACCC
Long Flanking Sequence:
GAGTGTAAAGAGACATGCACCTGCACAGCTGGAGTGTTCACCTGTGTACCCATGGAATGTAAAAAAGAGGAGATTTGTGACATAAAAGAGGGTGCCGTTGGATGTTACAGCAAAAGTATTTAGATTTAGAACTATACCAAAAGAGATAAATATATGTTTTTGTGCAAGTCTTTTCATTTTGTTTCTTTTTGTTGTTAAATCCTTCAAGAAACATACTGTCCAGTCAACATGCACTATGAGGCCTGCGGCACAGCCTGTGCTCCCACTTGTGCTAATCGAGATGGTCCAGAAAAGTGTGCACTGCCATGTGTGGAGGGCTGCCAGTGCAATGCAGGTTTTGTTCGCAGTGGCGATGAGTGCATACCTGTGAAACAGTGTGGCTGCGCTTACAAAGGCCAATATTATCTCCCTGGTCAGACATTTTGGGGTGAAAAACAATGCACAGAGAAATGTGTGTGCAACTCTCAAACAGGAAATGTTGAATGTGCACCTGCAAAGTG[T/A]ATGAATTCCCTGGTGTGTGGAGTACGGAATGGAGTGAAAGATTGTTACCCATTGTCATATAGTACCTGCCAGGGTGCAGGAGATCCACACTTCCGCACATTTGATGGCAAGGCATTCGACTTCCAAGGAACCTGCACATATTATTTGTCCAAACTACTGAACACAGCTGACCCGACACTGATACCCTTTGAAGTATTGGTCAAGAATGAGAACAGAGGAAGGAACTTGGCAGTTGCTTACACTAAGAGTGTATCATTAACAGTTTATGGATACACAATTGTCTTAAGTAAGGAAAGCCCAGGCAAAGTGAAGGTCAGTTCATTGAAAAGACTTTTATACTCTGTCTAGTAAAATACTGCATGCACAAACTGAGATAAATGTTACTGCACACTCATCTACAAAAACATGGGTTTGTCCATTAATGAAGTTAATTTGTTTTAAAGGTCAACGATCTGTTTGTGAAATTGCCATTTGAACTGGAAGATGGTCGACTCTCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40528
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 2999 4234 18 27
ENSDART00000134326 None None 895 None 8
ENSDART00000135772 Nonsense 442 591 3 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43452066)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41233331
GRCz11 5 41833484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACAGAGAAGGGACCGTTTTCTAGTTGTTATGATAAAATTCCACCACAG[A/T]AATATTTTGATGATTGTGTCAAAGATGTGGCACAAGCAACAGACAAGGCA
Long Flanking Sequence:
ATGTTTTAGTTACTGATCATTGTTTTAAGAGATCAAGATTCACTGACTACAAAGTGTTTTGTCAACCTTTTTTACAGGTTGACAAAGTTAAAACCAATCTTCCTGTCACTGTGGGTGAAGGACTTATACAAGTCTATCAGAGTGGTATTAACATTGTTGTGGAAACAGACTTTGGATTGAAACTGACATATGATACAGTCTCCGTGGCCAGAATTGAGATCCCATCCACTTTTAAAAATGCAGTCAGAGGTCTCTGTGGAAACTACAATGGAAACAGTGCAGATGATTTTCTCCTACCAGGTGGTATTCAGGCATCTTCTGAGGTAGATTTTGTTGAAGCCTGGGTTTCAGCATCAGATAAAATGATGTGCCAAACAGGCTGTGGGGCTAACTGTTTAAAGCCTGACAAAGACAAACAGACCACAGCAGAGACCGTTTGCAGCTTGTTAATCACAGAGAAGGGACCGTTTTCTAGTTGTTATGATAAAATTCCACCACAG[A/T]AATATTTTGATGATTGTGTCAAAGATGTGGCACAAGCAACAGACAAGGCAGCTCATTGTCGCCACATACAAAACTACGTTGCCAGCTGTCAAGCGATTGGGATATCAATCATTGTTTGGAGGAACACAACCTTCTGTCGTAAGTTGTCGCATCCTTCAGGTTTATTAATAATTCTCTTCAAGCTTCTCTATATGCCCCTACTTAGGTCTGCTGATGGAGTTTTGGAAAAGTAAACATTCTACTTTAAACTGAACCCAAATCATTTTGTTAAAATTGCTTTGTTTTCTTCCAGCACTGACATGTTTTAAAAACAGCCACTATGAACTCTGTACCGACACCTGTTCATCTACCTGTGCAAGCCTGACAAAGTCACAGAGATGCCCGTTGTGTCAGGAAGGTTGTCAGTGTGACGATGGTTTCTTGTTTGATGGAGGTGAATGTAAGGCTTTGCAGGATTGTGGATGTCATGTAGATGGAACATTTTACAAGGTGAGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15283
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 3721 4234 22 27
ENSDART00000134326 Nonsense 387 895 3 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43448878)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41230143
GRCz11 5 41830296
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTTCTCCTACCTGATGGTATTCAGACMTCTTCTGTGGAATACTTTGCT[G/T]AAGCCTGGGTTTCGCCATCRGATAAAAKGAWGTGCCAAAYAGGCTGTGGA
Long Flanking Sequence:
GAGTATAGGTTGGTTGAAGCAGTTCAGATTCAGGATGTAAAGAGCTCTTTCAGTGTCTTAATAAAACAACAGTCCTCTGAGATGGTCTTCACTCGAAAAGTTGAAATACAGTTACAGCAATCCACAATTACTTTGCTGCCCGGCCACATCTGGGAGGTTCAGGTAATGTTTTAGTTACTGATCATTGTTTTAAGAGATCAAGATTCACTGACTACAAAGTGTTTTGTCAACCTTTTTTACAGGTTGACAAAGTTAAAACCAATCTTCCTGTCACTGTGGGTGAAGGACTTATACAAGTCTATCAGAGCGGTATTAACATTGTTGTGGAAACAGACTTTGGATTGAAACTGACATATGATACAGTCTCAGTGGCCAAAATTGAGATCCCATCCACTTTTAAAAATGCAGTCAGAGGTCTCTGTGGAAACTACAATGGAAACAGTGCAGATGATTTTCTCCTACCTGATGGTATTCAGACATCTTCTGTGGAATACTTTGCT[G/T]AAGCCTGGGTTTCGCCATCGGATAAAATGATGTGCCAAACAGGCTGTGGAGCTAACTGTTTAAAGCCTGACAAAGACAAACAGACCACAGCAGAGACCGCTTGCAGCTTGTTAATCACAGAGAAGGGACCCTTTTCTAGTTGTTATGATAAAATTCCACCACAGAAATATTTTGATGATTGTGTCAAAGATGTGGCACAAGCAACAGACAAGACAGCTCATTGTCGCCACATGCAAAACTACGTTGCCAGCTGTCAAGCGATTGGGATATCAATCATTGTTTGGAGGAACATAACCTTCTGTCGTAAGTGGTTGCGTGTTAGCAAATACACCCTTGGCATTCAGTTGAAGAGGATACAGTTCAAAATGGAATTGTATCTGCAAAATTTTACTGTATAGCCAATAGCTGGTCAATAAAAACAACCTTATATTTTTTTTCAGCAATCATGTGTTTGGCAAACAGTCACTATGAGCTTTGTACCGACACCTGTTCTTCAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20506
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 3805 4234 22 27
ENSDART00000134326 Nonsense 471 895 3 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43448624)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41229889
GRCz11 5 41830042
KASP Assay ID:
2259-6340.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGACAAGACAGCTCATTGTCGCCACATGCAAAACTACGTTGCCAGCTG[T/A]CAAGCGATTGGGATATCAATCATTGTTTGGAGGAACATAACCTTCTGTCG
Long Flanking Sequence:
AAAACCAATCTTCCTGTCACTGTGGGTGAAGGACTTATACAAGTCTATCAGAGCGGTATTAACATTGTTGTGGAAACAGACTTTGGATTGAAACTGACATATGATACAGTCTCAGTGGCCAAAATTGAGATCCCATCCACTTTTAAAAATGCAGTCAGAGGTCTCTGTGGAAACTACAATGGAAACAGTGCAGATGATTTTCTCCTACCTGATGGTATTCAGACATCTTCTGTGGAATACTTTGCTGAAGCCTGGGTTTCGCCATCGGATAAAATGATGTGCCAAACAGGCTGTGGAGCTAACTGTTTAAAGCCTGACAAAGACAAACAGACCACAGCAGAGACCGCTTGCAGCTTGTTAATCACAGAGAAGGGACCCTTTTCTAGTTGTTATGATAAAATTCCACCACAGAAATATTTTGATGATTGTGTCAAAGATGTGGCACAAGCAACAGACAAGACAGCTCATTGTCGCCACATGCAAAACTACGTTGCCAGCTG[T/A]CAAGCGATTGGGATATCAATCATTGTTTGGAGGAACATAACCTTCTGTCGTAAGTGGTTGCGTGTTAGCAAATACACCCTTGGCATTCAGTTGAAGAGGATACAGTTCAAAATGGAATTGTATCTGCAAAATTTTACTGTATAGCCAATAGCTGGTCAATAAAAACAACCTTATATTTTTTTTCAGCAATCATGTGTTTGGCAAACAGTCACTATGAGCTTTGTACCGACACCTGTTCTTCAACTTGTGCTAGCCTGACAAACTCACAGAAATGTCCACCATGCCAGGAGGGATGTCAATGTGATGATGGCTTCTTGTTTGATGGAGGTGAATGCAAGGCTTTCCAGGACTGTGGCTGTCAAGTAGGTGGAAGGTTTTACAAGGTAAGAACTATTTTTTCTCTTGCAACAAAAACTATCCCACAAGCCACCAGGTGATGTTCAGTTTCTTGTCTCTCCTTTGTTCTGCAGTCTGGTGAGACAGTCGTTCGGGGAGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14461
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Nonsense 3919 4234 24 27
ENSDART00000134326 Nonsense 585 895 5 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43448060)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41229325
GRCz11 5 41829478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGCAAAGCTGGATTATTCACCTGTGAACCCTTGAAATGTGATGCTGAT[C/T]AGATCTGTGATAATATAGARGGCATCACCGGATGCTACAAGAAAGGTAAG
Long Flanking Sequence:
GTTAGCAAATACACCCTTGGCATTCAGTTGAAGAGGATACAGTTCAAAATGGAATTGTATCTGCAAAATTTTACTGTATAGCCAATAGCTGGTCAATAAAAACAACCTTATATTTTTTTTCAGCAATCATGTGTTTGGCAAACAGTCACTATGAGCTTTGTACCGACACCTGTTCTTCAACTTGTGCTAGCCTGACAAACTCACAGAAATGTCCACCATGCCAGGAGGGATGTCAATGTGATGATGGCTTCTTGTTTGATGGAGGTGAATGCAAGGCTTTCCAGGACTGTGGCTGTCAAGTAGGTGGAAGGTTTTACAAGGTAAGAACTATTTTTTCTCTTGCAACAAAAACTATCCCACAAGCCACCAGGTGATGTTCAGTTTCTTGTCTCTCCTTTGTTCTGCAGTCTGGTGAGACAGTCGTTCGGGGAGAGTGTGAGGAGACATGCCTCTGCAAAGCTGGATTATTCACCTGTGAACCCTTGAAATGTGATGCTGAT[C/T]AGATCTGTGATAATATAGAAGGCATCACCGGATGCTACAAGAAAGGTAAGTATATCTTTAATGAACATTTTAAATCATTACACAATAAACATTGTAAGTCATTTACCATTTTCTAAATTAGACCTGATTAGGTTTCAATGATGTTCATCTCTCTTCCAGATCCTTGCAGTAAGCAACAGTGTCGAGAACAAGAGTACTGCACTGTGAAGGATAACAAGGCACTCTGCATCGCAAAGTCAAAAGCCTCTTGCATTGCCAAGGGAGATCCTCATTACAAAACCTTTGATGGAAACCACTTCTCCTTTCAGGGAACTTGCACATATACTTTAGTTAAAACTTCAGGAAAAGACCAAACACTTACACCATTCAGCATCATCAATAAAAATGAGTTCACCAAAGGCACCCGCGGCTCTTTTGTCAAGTCAGCCACCATTACGGTCAGAGGACATGACATCACTTTCATCCAAGGCAGCCGCAATCATGTGACAGTAAGTACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5813
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112382 Essential Splice Site 4231 4234 26 27
ENSDART00000134326 Splice Site None 895 None 8
ENSDART00000135772 None None 591 None 5
ENSDART00000141683 None None 602 None 5
ENSDART00000146793 None None 591 None 5
Genomic Location (Zv9):
Chromosome 5 (position 43445937)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41227202
GRCz11 5 41827355
KASP Assay ID:
554-3553.1 (used for ordering genotyping assays)
KASP Sequence:
TAAATGCTGATGTSTCTCCAGACTGGAAGAAGCTTGCTAATTGCTGTAAG[T/C]AATGTCTAAGGCTCAAGTCTTTAATTAATAGATATTATATTTATCCTAAC
Long Flanking Sequence:
CACGCAATGTAGGAGTTCTTCAAACAGATTTTGGCTTGGAGGTCATGTTTAATTGGGCAGATACCATTATGGTGACATTGTCCAGTAGCTACTATAATAATGTAGTTGGAATGTGTGGAACCTACAGTAACAAACTGGACGATGATTATATCACACCCAATGGTAACAGAATAACTGACATCACAGAATGGGCGACGTCTTGGAGTGTCCCTGAAACCAACAGCAACTGCTGGCACTTTCCCCCTTGCTCGGATGAAAAGAAGCTGCTCTATAGCGGACAAAGCTACTGTGGTTTGATAGAGAATGTAACCGGCCCATTTGCCCAATGCCATGACATTATATCAAAGAGGCGTTTCGCTGCTGACTGCCTTTTCCAAATGTGTCTTAATGAAGGCAGTCAGAAGGCTTTCTGCAATGCCTTCAATAATTATGTGTCAGCGTGTGCGCTGGTAAATGCTGATGTCTCTCCAGACTGGAAGAAGCTTGCTAATTGCTGTAAG[T/C]AATGTCTAAGGCTCAAGTCTTTAATTAATAGATATTATATTTATCCTAACATCCTTTGTTTTTTCCCCAACAGGATGAATTTTGTTTTCTTCGCCGGACTGCTTACATCCCAAAAAACAGTGAATATGATTATGAATTAATAAATTAAATTTGGTTGTGAATTCAAAATGAATGTATTCACTCACAATATAATGTCTCAGATTTTATTATTACATATGTGATATGGTGTTTAAAAGGCATGTTTAAGTCTTGTTTTTTTTTTCTTAAAGAAATACATGAGTGCCAGCTTGTCCTGTTCAGAAATCAGTTAATTATTAATCTTGGGTAAAATTGATTTGTTTCAAAAGTAGATGTATTCTTTTAAATGCCTCGTTACTTATTAAACTCTTGCATCATTAAGCTATTTAGCAGTGTCATTTCTTGTTTAAGTGAATTTTTTAATTAGAAGCTGCCCATCAATCACAATCTGTTTATTGCTCTCTCTCTCTCTCTCTCTCTCT
Associated Phenotype:
Not determined