Busch Lab

ZMP

bx248082.1

Ensembl ID:
ENSDARG00000076829
ZFIN ID:
ZDB-GENE-100920-6
Human Orthologue:
ANKIB1
Human Description:
ankyrin repeat and IBR domain containing 1 [Source:HGNC Symbol;Acc:22215]
Mouse Orthologue:
Ankib1
Mouse Description:
ankyrin repeat and IBR domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918047]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa2840 Nonsense F2 line generated Not yet available
sa6417 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11390 Nonsense Available for shipment Available now
sa22790 Nonsense Available for shipment Available now
sa39085 Nonsense Mutation detected in F1 DNA Not yet available
sa22789 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2840
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Nonsense 337 1074 6 19
ENSDART00000131227 Nonsense 337 1074 7 20
Genomic Location (Zv9):
Chromosome 16 (position 18135258)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16176495
GRCz11 16 16084472
KASP Assay ID:
554-2580.1 (used for ordering genotyping assays)
KASP Sequence:
CATATTCACACTCAAGTTGCTGTATTTTTCCCTTTTCAGTGCGGTATTTG[T/A]ATGTGCGCTGCTTCCATGTTTGAAGAGCCTGTTGAWATTCCTTGTGGTCA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa6417
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Essential Splice Site 363 1074 6 19
ENSDART00000131227 Essential Splice Site 363 1074 7 20
Genomic Location (Zv9):
Chromosome 16 (position 18135179)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16176416
GRCz11 16 16084393
KASP Assay ID:
554-4786.1 (used for ordering genotyping assays)
KASP Sequence:
CTGTTGAWATTCCTTGTGGTCATGAGTTCTGCAGGGGATGCTGGGAAAGG[T/A]GAGCTTTTATTTCTTTTTTTTTATTCAGTATTTTAGTCACACTGWGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11390
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Nonsense 537 1074 10 19
ENSDART00000131227 Nonsense 537 1074 11 20
Genomic Location (Zv9):
Chromosome 16 (position 18129495)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16170732
GRCz11 16 16078709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCCAACTGCAAATCTCCCATTCAGAAGAATGAGGGATGTAACCACATG[C/T]AATGTGCCAAGGTTATTTGCGTAATAACAATAATAGATCTATTTATAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22790
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Nonsense 568 1074 11 19
ENSDART00000131227 Nonsense 568 1074 12 20
Genomic Location (Zv9):
Chromosome 16 (position 18126242)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16167479
GRCz11 16 16075456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGTGGAAAAAACACAGTTCCTCTACTGGAGGGTACTACCGCTGCACA[C/T]GATATGAGGTCATTCAGCAAGTGGAGGAGCAGTCTAAAGAGATGACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39085
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Nonsense 610 1074 12 19
ENSDART00000131227 Nonsense 610 1074 13 20
Genomic Location (Zv9):
Chromosome 16 (position 18125802)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16167039
GRCz11 16 16075016
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGGAATTAGATCGCTTCATGCATTATTACACACGTTTTAAGAACCAC[G/T]AACACAGTTACCAGGTAAAAAAAAATCATTAATAATTCTAACTTGTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22789
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Essential Splice Site 762 1074 16 19
ENSDART00000131227 Essential Splice Site 762 1074 17 20
Genomic Location (Zv9):
Chromosome 16 (position 18102875)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16144112
GRCz11 16 16052089
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCTGGTGGAACATGGGACTGGGAGTATTTGGGTTTCGCCTCTCCTGAG[G/A]TAACATTTTTTAAGCCTGTTTTACAAACTTTGTGTTATTTGTGTCTTAAA
Associated Phenotype:
Not determined