Busch Lab

ZMP

si:ch211-232k18.1

Ensembl ID:
ENSDARG00000076826
ZFIN ID:
ZDB-GENE-091204-242
Human Orthologue:
DPP6
Human Description:
dipeptidyl-peptidase 6 [Source:HGNC Symbol;Acc:3010]
Mouse Orthologue:
Dpp6
Mouse Description:
dipeptidylpeptidase 6 Gene [Source:MGI Symbol;Acc:MGI:94921]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44084 Nonsense Mutation detected in F1 DNA Not yet available
sa44083 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44084
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080766 Nonsense 16 682 1 22
ENSDART00000143613 None None 113 None 4
Genomic Location (Zv9):
Chromosome 24 (position 7010777)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6868069
GRCz11 24 6897388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATCATGACCACTGCAAAGGAGTCAAATATATCGACCAAAACAGCTCAA[C/T]AGCAAGAACAGGTACTGGAGAGATTTATTTATCTTTGTTTGGTCACTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44083
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080766 Essential Splice Site 91 682 4 22
ENSDART00000143613 Essential Splice Site 73 113 3 4
Genomic Location (Zv9):
Chromosome 24 (position 6890012)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6747304
GRCz11 24 6776623
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTGACGTTCTATAGCGCTAACTCTTATCCTTTTATCCTCTCCCTTTA[G/T]ATAATGAGCTCCTCTATCGTACCCGTGAAGGTGACGTGGTTCGCTTCAAC
Associated Phenotype:
Not determined