Busch Lab

ZMP

zgc:158262

Ensembl ID:
ENSDARG00000076805
ZFIN ID:
ZDB-GENE-070410-6
Description:
Leukocyte receptor cluster member 8 homolog [Source:UniProtKB/Swiss-Prot;Acc:A4QNR8]
Human Orthologue:
LENG8
Human Description:
leukocyte receptor cluster (LRC) member 8 [Source:HGNC Symbol;Acc:15500]
Mouse Orthologue:
Leng8
Mouse Description:
leukocyte receptor cluster (LRC) member 8 Gene [Source:MGI Symbol;Acc:MGI:2142195]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42672 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1304 Nonsense Available for shipment Available now
sa10160 Nonsense Available for shipment Available now
sa19133 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42672
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113345 Essential Splice Site 14 839 1 15
Genomic Location (Zv9):
Chromosome 16 (position 14015906)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12374997
GRCz11 16 12265899
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGCAAAATGGCGGCGAATGCGGCTCAACAAGCCCCGACACAAAACTGG[T/A]AAGGCGTTTTTATATCTCATTAATGACATCTTCACGTTTCTAACGAATTT
Long Flanking Sequence:
TTTCTGCATTTCCTTTTTAGCACAGAAAATATACTTAATACATTTATGACTGTACACATATTCTGGCCTGTTTGCCATTAAGCGTGTGTGTGGTTTGCTCTGCTCGTATGCAGAACATTCAGTCCTCCAAAAATGAAAAATAAATAAATCAAGTCCTCCAATGAGAGAACGCTGAAGAACATTTCCGGCGACTGCGTCCTCACCGGCAGCCATTTTGTTTGAGGTGTTGACATTCATCCGTTGAGTTCGGAGAACTAGTTGATATGGGCGTCAGTTTAACTCTGATATCGACAGGAACGTATTTAATTTAAGACAGTCGGTATACACTATTGTTAAACATTTTTGTAGCAGATTATATAGTAAATATTTTCTATTAAGCGTTAGTACGATTTCTTTTCTCATATTTGCGTAGATTTTTTCTACGAGCTAACAGTAACTAACTGGTTAGCTCTGGCAAAATGGCGGCGAATGCGGCTCAACAAGCCCCGACACAAAACTGG[T/A]AAGGCGTTTTTATATCTCATTAATGACATCTTCACGTTTCTAACGAATTTTGTCTGTTAAACGTGTCTCACCTAAAGGTTTCACTGCATATTTTGAGGTACAAATAGGTGTAACAATCGATTGAGATTTTGGCGTTCGCTAGCTTATCCGCTTCTCTTTGCAGATTTAACGAATTATTTCGTAGTATCGGCCTGCCATTTTTAATAAGTTGGATATAGGTTGATGTTTTTATTTTTATTTTATTTTTTTCTGTTAAAGGTAGTCCATACTAGAACTGGAATCGAGTGGAATTAACGTCTGTCTTGTTGTAAAGGCCTCATTGGTGACCAGCATATTTATCATTGCTAAGTTACACTGTTTCTTATCGTTATGGCTTTTAATCAAAAAAACTTTTAGCGAAACAAGCCAGACACAGTATGCTTAACAAATCTGAACAAGTTTTAGGAAATGCAATGACTCTTAAAATTCACTTGCCAAAATAACGTTACGAATATTACACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7781
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113345 Nonsense 82 839 3 15
Genomic Location (Zv9):
Chromosome 16 (position 14014955)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12374046
GRCz11 16 12264948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGTTACAGACTCCTCTGCAATGCAGCAGCAGCAGTATTATCAGCAGTG[G/A]TATCAAYAGAACCAACAGCAGTATGCTGGTTACCCTTATCCTTATAACTA
Long Flanking Sequence:
CAATGACTCTTAAAATTCACTTGCCAAAATAACGTTACGAATATTACACCGTCTGCAGTCAGTTTTTGTTTGTATATGAACCTTGTTTTGTGTGGGTCACGGTGTGCTTGTGTAGATGTATGTAAATGTTTTTAAAAGGTCTGATATGCCGTGAACTAAAATCCATATTACGTTTACCTTACCATGTTTTCATCTGCAGGCCGTATGGTAATAATTCAAGTGGTGAAGGCCCAGTCCACGAGAACCCAGAATGGGAAAAGGCCCGACAGGCTCTAGCATCCATCAGTAAAAGTCAAAACTCTACCAAACCTTCAACTAATCAAACCACACAACAGGTTAGTGTTTCATGAGAATAGAGGTGGACATTTTTATCAGTTTTAAACCCATGCTTTATTGCGTGGTAAAATGGTTGATTTTTGATTTTTCTGTTAGGCTGGACAGTATCAGGCAGCAGTTACAGACTCCTCTGCAATGCAGCAGCAGCAGTATTATCAGCAGTG[G/A]TATCAACAGAACCAACAGCAGTATGCTGGTTACCCTTATCCTTATAACTACTACTACCCCATGCCTCCGGTAAATAAATGCACTCCTACATTTTTGAACATGTATCTGTAAACAGTCCTTATCCATTTCCCTTTAAATCTTAACCGAAAGGTTAGCTGCAGAGAGTAAGCAGTTTTTTTTTTTTTTTTTTTTTTAAGCGTTTGTGTTTGATTGGAGCTTTTATACCACACACTGAAGCAGCATTGCTGTAATTATTTTGGTCCTTGGTCTATTTTTAACACACTGATTACGTTCAGTTAAAGTGATAATGCATTAGTTATGACCAAAAACAAATAGAAAAAATTGACAGCCGAAAAAGTAGAAGTTTTACCCAAAAAAATGCATGGACAATTTCCACTGGTTTTTATATTGTCAATCAAATGAACTGAAACGATTTAAAAATGCAACAAGTATTTGTTTGGGTCTGAACTACAAAACTACATTTAAAACAAAATTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1304
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113345 Nonsense 85 839 3 15
Genomic Location (Zv9):
Chromosome 16 (position 14014948)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12374039
GRCz11 16 12264941
KASP Assay ID:
554-1219.1 (used for ordering genotyping assays)
KASP Sequence:
CAGACTCCTCTGCAATGCAGCAGCAGCAGTATTATCAGCAGTGGTATCAA[C/T]AGAACCAACAGCAGTATGCTGGTTACCCTTATCCTTATAACTACTACTAC
Long Flanking Sequence:
TCTTAAAATTCACTTGCCAAAATAACGTTACGAATATTACACCGTCTGCAGTCAGTTTTTGTTTGTATATGAACCTTGTTTTGTGTGGGTCACGGTGTGCTTGTGTAGATGTATGTAAATGTTTTTAAAAGGTCTGATATGCCGTGAACTAAAATCCATATTACGTTTACCTTACCATGTTTTCATCTGCAGGCCGTATGGTAATAATTCAAGTGGTGAAGGCCCAGTCCACGAGAACCCAGAATGGGAAAAGGCCCGACAGGCTCTAGCATCCATCAGTAAAAGTCAAAACTCTACCAAACCTTCAACTAATCAAACCACACAACAGGTTAGTGTTTCATGAGAATAGAGGTGGACATTTTTATCAGTTTTAAACCCATGCTTTATTGCGTGGTAAAATGGTTGATTTTTGATTTTTCTGTTAGGCTGGACAGTATCAGGCAGCAGTTACAGACTCCTCTGCAATGCAGCAGCAGCAGTATTATCAGCAGTGGTATCAA[C/T]AGAACCAACAGCAGTATGCTGGTTACCCTTATCCTTATAACTACTACTACCCCATGCCTCCGGTAAATAAATGCACTCCTACATTTTTGAACATGTATCTGTAAACAGTCCTTATCCATTTCCCTTTAAATCTTAACCGAAAGGTTAGCTGCAGAGAGTAAGCAGTTTTTTTTTTTTTTTTTTTTTTAAGCGTTTGTGTTTGATTGGAGCTTTTATACCACACACTGAAGCAGCATTGCTGTAATTATTTTGGTCCTTGGTCTATTTTTAACACACTGATTACGTTCAGTTAAAGTGATAATGCATTAGTTATGACCAAAAACAAATAGAAAAAATTGACAGCCGAAAAAGTAGAAGTTTTACCCAAAAAAATGCATGGACAATTTCCACTGGTTTTTATATTGTCAATCAAATGAACTGAAACGATTTAAAAATGCAACAAGTATTTGTTTGGGTCTGAACTACAAAACTACATTTAAAACAAAATTTAGTGTCAGTTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10160
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113345 Nonsense 641 839 11 15
ENSDART00000113345 Nonsense 641 839 11 15
Genomic Location (Zv9):
Chromosome 16 (position 14011202)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12370293
GRCz11 16 12261195
KASP Assay ID:
2260-9323.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTAAAGGCTCATTGGAAAAGCAATCAGGACTAYGTCTACGCATGTGAA[C/T]AAATGAAATCCATAAGACAGGATCTAACTGTRAGTGATGACTTTTAGTAC
Long Flanking Sequence:
TACTTTCTCCTATGACTTCTTTCAGGAATATGGAAGACCTAGCCAGTGGCGTTGGTAAAAAACGTAAAGGTGGTAATGCAGGCCTTGACTTTCACGACCCAAATCGTGAAGCAAAGAAACAGAGCCGTGCAGCACGCTTCCACACTAAACTACGCACTGAGCCCCTGGTGTTAAACATCAATGTTTTTGACCTCCCCAACGGTACCCAAGAGGGATTAAGTTGGGATGACTGCCCCATAGTTGGCACCTGCCAGGACATCACAAAAAACTACCTCCGTCTCACCTGTGCCCCAGATCCTTCAACCGTCAGGCCTGTACCTGTGAGTGTTTCTCAGAATGTTGCTTGTCTTTTGAGCGAATGATTTGTGTTATTTGTGGTCTGTGGTTGTCAGTTTAATGCAAAAATTGCTTTAAAAATTGTGTTTTAGGTGTTGCGAAAATCCTTGATTGCAGTAAAGGCTCATTGGAAAAGCAATCAGGACTATGTCTACGCATGTGAA[C/T]AAATGAAATCCATAAGACAGGATCTAACTGTGAGTGATGACTTTTAGTACCATTTACCTGTCTTGCCTTTTTTAGTGTCTTATTTTGAAATGTCTTAATCAGGTGCAAGGTGTACGTACAGACTTTACAGTGGAGGTGTATGAGACGCATGCTCGCATTGCTCTGGAAAAGGTATGAAGGGAAATGTCTTTGTTGAATTAAGTCACAGTATTTTACTATTAATGTATTGGTATTAGACAACCAACCTCATTTTTCTGTTGTTTTTAGGGCGACCATGAGGAGTTCAACCAGTGTCAAACACAGCTGAAGGCGCTGTATAAAGACTGTCCATCAGACAACGTTGGAGAATTCACTGCCTACAGACTTATCTACTACATCTTTACTAAGAACTCTGGAGGTATAGCTATAAATTGCTTTTGCTTTACCAGCAGTTTAATATTTATTTTTATTATTTTGGGGTTCTTATGTATTCTCGTATGAAGCCTTTAATAATCTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19133
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113345 Nonsense 641 839 11 15
ENSDART00000113345 Nonsense 641 839 11 15
Genomic Location (Zv9):
Chromosome 16 (position 14011202)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12370293
GRCz11 16 12261195
KASP Assay ID:
2260-9323.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTAAAGGCTCATTGGAAAAGCAATCAGGACTATGTCTACGCATGTGAA[C/T]AAATGAAATCCATAAGACAGGATCTAACTGTGAGTGATGACTTTTAGTAC
Long Flanking Sequence:
TACTTTCTCCTATGACTTCTTTCAGGAATATGGAAGACCTAGCCAGTGGCGTTGGTAAAAAACGTAAAGGTGGTAATGCAGGCCTTGACTTTCACGACCCAAATCGTGAAGCAAAGAAACAGAGCCGTGCAGCACGCTTCCACACTAAACTACGCACTGAGCCCCTGGTGTTAAACATCAATGTTTTTGACCTCCCCAACGGTACCCAAGAGGGATTAAGTTGGGATGACTGCCCCATAGTTGGCACCTGCCAGGACATCACAAAAAACTACCTCCGTCTCACCTGTGCCCCAGATCCTTCAACCGTCAGGCCTGTACCTGTGAGTGTTTCTCAGAATGTTGCTTGTCTTTTGAGCGAATGATTTGTGTTATTTGTGGTCTGTGGTTGTCAGTTTAATGCAAAAATTGCTTTAAAAATTGTGTTTTAGGTGTTGCGAAAATCCTTGATTGCAGTAAAGGCTCATTGGAAAAGCAATCAGGACTATGTCTACGCATGTGAA[C/T]AAATGAAATCCATAAGACAGGATCTAACTGTGAGTGATGACTTTTAGTACCATTTACCTGTCTTGCCTTTTTTAGTGTCTTATTTTGAAATGTCTTAATCAGGTGCAAGGTGTACGTACAGACTTTACAGTGGAGGTGTATGAGACGCATGCTCGCATTGCTCTGGAAAAGGTATGAAGGGAAATGTCTTTGTTGAATTAAGTCACAGTATTTTACTATTAATGTATTGGTATTAGACAACCAACCTCATTTTTCTGTTGTTTTTAGGGCGACCATGAGGAGTTCAACCAGTGTCAAACACAGCTGAAGGCGCTGTATAAAGACTGTCCATCAGACAACGTTGGAGAATTCACTGCCTACAGACTTATCTACTACATCTTTACTAAGAACTCTGGAGGTATAGCTATAAATTGCTTTTGCTTTACCAGCAGTTTAATATTTATTTTTATTATTTTGGGGTTCTTATGTATTCTCGTATGAAGCCTTTAATAATCTTGTTT
Associated Phenotype:
Not determined