Busch Lab

ZMP

si:dkeyp-68a7.2

Ensembl ID:
ENSDARG00000076804
ZFIN ID:
ZDB-GENE-100922-257
Human Orthologue:
TTYH1
Human Description:
tweety homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:13476]
Mouse Orthologue:
Ttyh1
Mouse Description:
tweety homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889007]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12432 Essential Splice Site Available for shipment Available now
sa11736 Essential Splice Site Available for shipment Available now
sa42682 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa28607 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12432
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115173 Essential Splice Site 273 514 4 14
ENSDART00000136994 None None 132 None 8
ENSDART00000138540 Essential Splice Site 152 470 2 12
ENSDART00000138772 None None 119 None 6
Genomic Location (Zv9):
Chromosome 16 (position 15494505)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13852964
GRCz11 16 13743084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTCTCCTGGATGGGCRGCAAACACCCTCATGGTGAATGAAGACTACAG[G/A]TGAGGAAGACTAGGGAAGATAATGAGATTYTGTAGGYTAAAGGGGACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11736
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115173 Essential Splice Site 305 514 5 14
ENSDART00000136994 None None 132 None 8
ENSDART00000138540 Essential Splice Site 184 470 3 12
ENSDART00000138772 None None 119 None 6
Genomic Location (Zv9):
Chromosome 16 (position 15492950)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13851409
GRCz11 16 13741529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTCATTCTCCTGGGTTTAGCCAAACAGTCCCGCTGGCTACTTATTCTG[T/A]RAGTAACACTMATTACTGATCWGCTCTGTGCAAGCAAGTGCTGATATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42682
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115173 Essential Splice Site 435 514 10 14
ENSDART00000136994 None None 132 None 8
ENSDART00000138540 Essential Splice Site 314 470 8 12
ENSDART00000138772 Essential Splice Site 40 119 2 6
Genomic Location (Zv9):
Chromosome 16 (position 15481335)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13839794
GRCz11 16 13729914
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTTCCATCAGCTGGTTGCTCTTCTCAACTGTCGAGGCCTGAACAAGG[T/C]AAACATGGCAGCCTGGTTTTTACCTCAGCCAAGCAGTTTTCATGTCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28607
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115173 Essential Splice Site None 514 14 14
ENSDART00000136994 Essential Splice Site None 132 8 8
ENSDART00000138540 Essential Splice Site 444 470 12 12
ENSDART00000138772 Essential Splice Site None 119 6 6
Genomic Location (Zv9):
Chromosome 16 (position 15465637)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13824096
GRCz11 16 13714216
KASP Assay ID:
2260-9372.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCCCTTCTCTGCTCTCCTGAACTGCGGATCTGCCCGGTGGTTTCACA[G/A]TACTCTCCCAGCATGCTGACTGGCTACGGCGGCAGTCAATCACACTCCAA
Associated Phenotype:
Not determined