Busch Lab

ZMP

arap3

Ensembl ID:
ENSDARG00000076801
ZFIN ID:
ZDB-GENE-091019-1
Human Orthologue:
ARAP3
Human Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:24097]
Mouse Orthologue:
Arap3
Mouse Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2147274]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa35696 Nonsense Available for shipment Available now
sa12354 Nonsense Available for shipment Available now
sa35697 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35696
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 17 1664 1 33
Genomic Location (Zv9):
Chromosome 14 (position 27594564)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26287361
GRCz11 14 26585466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCACACTATGGCAACAATCGGTCCGTGCTCAGATGCAGAGGACCTGT[T/A]GGCTTCCATCCACCTGGAGAGGTATCTGGACCACTTCCGTCAGGCAGGCT
Long Flanking Sequence:
GTTGTTGGTGCCTTGGTGGGATTATTTGTGTTATAAATCTAGTTGTTATTCAGCACATTATTTATTTACTACACAGAGGGTCTATACAGGGGTGGGCAATCTCGGTCCTGGAGGGCCGGTGTCCTGCACAGTTTAGCTCCAACCCTATTTAAACAGACCTCCCTATAGAGTTCAAGTGATCTTGAAGACACTGATTAGTTTGTTCAGGTGTGTTTGACTAGTGTTGGAACAAAACTCTGCAGGGACACCGGCCCTCGAGGATCAAGTTTGCCCATTCCTGGTCTATAACCTTTAGTATTTTAGTGATATGGTTTTGCGTGTAATGAAACAGTTAGCAAACTTTTTTATCACTGTTTTTTTTTTCTTTTTGATATCGCAGATGAAGAACTGGTGTGGTCTTCTTCTCTTGGCTAAATCTGCTGCTGTTCCGCATGCAGCCTAATGAGCCCTCATGCACACTATGGCAACAATCGGTCCGTGCTCAGATGCAGAGGACCTGT[T/A]GGCTTCCATCCACCTGGAGAGGTATCTGGACCACTTCCGTCAGGCAGGCTTTCTTCTCGCCCGAGACTTCTGTCATGTGGACAATGCCGCTCTGAACCGGGTCGGAGTCGCTGCCACCGGCCACAGGAAGCGGATCCTCAAACTGGTGGAGCACATTCAGCTGATCTGCCAACATCAAAGCAAAGAGCCATCGCTAGATCGTTGTAATTCAGAATCCGCTATTCACGATGTAACTCCTGTCAAAGCCAAGCCTCTTTCCCCTTCAAAACCTCCTGGCACCACTTTCCAAGCCTTACGCAACAGCTCTGCCCCCAATCTTTGTGCACAAGTCAAGCGCTCATTCTCGGAACGCAGCACCAGTGTTGTAAAGCCGGTACCAAAACCAAGAACTGTCTTCCACAAACTGAGAGGAGACAAATTCTCTCTAGCGACGCAACACGAACACCGAAAGTCATCTCAGGATCCAGTTGTAATCGATTCATCCTCTCTTTCATCCAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3880
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 25 1664 1 33
Genomic Location (Zv9):
Chromosome 14 (position 27594589)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26287386
GRCz11 14 26585491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGTGCTCAGATGCAGAGGACCTGTTGGCTTCCATCCACCTGGAGAGGTA[T/A]CTGGACCACTTCCGTCAGGCAGGCTTTCTTCTYGCCCGAGACTTCTGTCA
Long Flanking Sequence:
TTGTGTTATAAATCTAGTTGTTATTCAGCACATTATTTATTTACTACACAGAGGGTCTATACAGGGGTGGGCAATCTCGGTCCTGGAGGGCCGGTGTCCTGCACAGTTTAGCTCCAACCCTATTTAAACAGACCTCCCTATAGAGTTCAAGTGATCTTGAAGACACTGATTAGTTTGTTCAGGTGTGTTTGACTAGTGTTGGAACAAAACTCTGCAGGGACACCGGCCCTCGAGGATCAAGTTTGCCCATTCCTGGTCTATAACCTTTAGTATTTTAGTGATATGGTTTTGCGTGTAATGAAACAGTTAGCAAACTTTTTTATCACTGTTTTTTTTTTCTTTTTGATATCGCAGATGAAGAACTGGTGTGGTCTTCTTCTCTTGGCTAAATCTGCTGCTGTTCCGCATGCAGCCTAATGAGCCCTCATGCACACTATGGCAACAATCGGTCCGTGCTCAGATGCAGAGGACCTGTTGGCTTCCATCCACCTGGAGAGGTA[T/A]CTGGACCACTTCCGTCAGGCAGGCTTTCTTCTCGCCCGAGACTTCTGTCATGTGGACAATGCCGCTCTGAACCGGGTCGGAGTCGCTGCCACCGGCCACAGGAAGCGGATCCTCAAACTGGTGGAGCACATTCAGCTGATCTGCCAACATCAAAGCAAAGAGCCATCGCTAGATCGTTGTAATTCAGAATCCGCTATTCACGATGTAACTCCTGTCAAAGCCAAGCCTCTTTCCCCTTCAAAACCTCCTGGCACCACTTTCCAAGCCTTACGCAACAGCTCTGCCCCCAATCTTTGTGCACAAGTCAAGCGCTCATTCTCGGAACGCAGCACCAGTGTTGTAAAGCCGGTACCAAAACCAAGAACTGTCTTCCACAAACTGAGAGGAGACAAATTCTCTCTAGCGACGCAACACGAACACCGAAAGTCATCTCAGGATCCAGTTGTAATCGATTCATCCTCTCTTTCATCCAGTACAGACACTGTTAAAACAGCTACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12354
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 586 1664 9 33
Genomic Location (Zv9):
Chromosome 14 (position 27604138)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26296935
GRCz11 14 26595040
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NCTTTTGTGTTTCACAGTGCTTTAAAAATGGGATTGGAATTACAGTAATT[G/T]AGGCGAGAGGTGCTACAATTCGTGATGGGAAGGGCAAGAGCTTTGATCTC
Long Flanking Sequence:
AATAGATCTGTAGAACAGCGCTTTACAGCGTATTTGAAGTTTTACTAGAGGCCTGCTTTATGTCTTTTTGTAGTCCAGAGGAGCAAATGGTGCAGCACGTTGCAGGAGCGGGTCAAAGAACAGCTGGTTTTTGGTCGCCCACGTTTTGGCCCCGGCAGTCACTGCCAAAAGAGCGGCTTCCTGGAGCTCAAAGGAACCAAGTCAAAGATCTACACCGCAATTATAATGGAGCAGATCTGGTTGTACAAGAGTGAGCAGGTGATTAGTTAATCACGTTATAGTTAATTGTGTTATAGCCATACCGCTGTAGATTTAATACCAGTGATTTGCTTTACCTTACAAAATGCAATTCAAGTGTTATAAAACCTTTGTAACTTCTCAAAGAATATGTGCAGTTTAACAAAAAATTATGCAAGTTATTTTATTAGTGATTTGTAAATAAAAGCTGGCTCTTTTGTGTTTCACAGTGCTTTAAAAATGGGATTGGAATTACAGTAATT[G/T]AGGCGAGAGGTGCTACAATTCGTGATGGGAAGGGCAAGAGCTTTGATCTCATTACACCTTATAAAACCTTCAGGTAAACGGCTGAAGTCACGCTATGCTTTTGTTAAGAAGATTGTACATGTTTAACCTCTTAAGCCATTTACAACAGAGCAAAAGCATTGTTTAATCTGTAATATTGATGTTTGTAGTGTATTTAATAACGCTATTTTTATTTATTACATCCATAATTTAAAAACGGTTAAGGCATTAATACAAATTATTATCATGTGCAATTTTGATCAGTTGTGTAGATGTTTTTAATGGGTGAAATGTAGATTTTTTTTTTGTACTTTTTAATAAATTTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATAGTCACTATAGAATTTTAAGGTTGTAACATTTTTGTTAAAATTGAGTTATTCACATATTCTTATAATTTAATAAGACATCATTTATTTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28313
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 641 1664 10 33
Genomic Location (Zv9):
Chromosome 14 (position 27605821)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26298618
GRCz11 14 26596723
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCCCTGCAGGAATCTATAGCCGAAACACTCTCTGACTACGAGGTGGCC[G/T]AGAAGATCTGGTCCAACAGGTCCAACAAGATCTGCGCAGACTGCAAAGCC
Long Flanking Sequence:
ATGGAATGCAAAAACTTTAAAGCTCACTATATCATAATCTTTTAGAACGCAAATAGAACCTTATAATTCCAAAGTGACTATATCATATTATATATATTAAATTACATTGTTATGCTGTTATAATAAATAAAGAATGTTATATTATCTAAAAATTATGCTAAATTACATTACATAAAAAATTATTACAACATTACTTTAAAATATTATTTGTTTATAAAAAAATATTCAGTACTATTTGAAATTTTAAGATCTGTAAACAATAAATAAACATAAAAAGTCCATTTAATTGTATATTCTATGAAACAAACACACACACAGAAGACACACTGTGGTTTATTTCCATAGACTAGAGCTATTTAATAAGATCTATGCAGGTAGAGTATTAAGAGTGTCGTGTGCACCATTGCAGCTTTACGGCAGAGACGGATCGTGAGAAGCGGGACTGGATGGAGGCCCTGCAGGAATCTATAGCCGAAACACTCTCTGACTACGAGGTGGCC[G/T]AGAAGATCTGGTCCAACAGGTCCAACAAGATCTGCGCAGACTGCAAAGCCATCAATCCAGACTGGGCATCAATCAACCTCTGTGTGGTCATCTGTAAAAACTGCGCAGGTCTGTGTGTGAGTGTGTGTGTGTGGCAGCTTAACAGACTGTTTTAACAGCTTGATGGCATTTAGAATTTCAGCTGAGACATTGCAGACAAAAACGTTTTGGCCTTTTGGCTTTTCATGCAGTAACTCCTCACTCTAATGCAAAGTAAACACTGTAAACACAAAGGCTGTTTTTTTACAATTAGTTAAGGGATAAATCTCCACTTCTGCAGCATTTAAATACATCAAATATATTATATATCTATATTCTGAAGGTTTTTCTAAACAATTCATACATAATTTTGCAGATTACATACAAACATTTTATTCTACAAATAGTTTTTTCTCTCCAGTATTTTCTATGTAACATTTTTTGACTGCAATATATGTCAAAAACCTGATCTCATCAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35697
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Essential Splice Site 901 1664 15 33
Genomic Location (Zv9):
Chromosome 14 (position 27612469)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26305266
GRCz11 14 26603371
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGGAGTCAGCAGGCCAGACTCCAGCAACAACAGCGGCTTTATTGACAA[G/A]TGAGAGCCACTGCTAACCAACATCCCTCAGGACATTTAAACATTAAAAAA
Long Flanking Sequence:
GAAGATAAAATAAATCAGTTATTAGAAATGAGTTATTAAAACTATCATGTTTAGAAATGTGTATCATGTTTAGAAATGTATAATATATATATATATATATAATTTTATTTTTTATATGTTTTTTATAATAATAATTTAAGTATTATCAATTTTACTGGATTTTTTTTAACACTTTAAAAATATTCAGATGGGCACTTGATTGCAACTTGGTTTTAAACAGCATTACTCTTATTCTTAATACCATAATTTGATGTGAAGCATTCATAAAATGACTGAGTACAAATACTAATACACATTCAGATGTTTCAGTTTTTGTTGTTTGATTGTTTTATTACTCTTTCAGCAGATTTCCAAAAATATTGGTGTTCGGTGGAGAAGTCTATTCTCTTTTATGAGTCTGACAGATGTCATGAGCCCAGTATGAAGATCGATGTTAAAGACATCATCTGTTTAGGAGTCAGCAGGCCAGACTCCAGCAACAACAGCGGCTTTATTGACAA[G/A]TGAGAGCCACTGCTAACCAACATCCCTCAGGACATTTAAACATTAAAAAAACTCTTAATAATCTTACTCTTGATGTTTTTCTCAGATTTCGCTACACTTTTGAACTTTACCTAATGTCTGATAAACTGGTCCAGTTTGGCTTGGAGACTCCAGATGCTTTGCACAGTTGGGCGAGAGCAATAGGGAAGGTAAATATGAATCAGAACTAGCTGTGTTTTATATGCAAAGGAAACAGTCGCATTGGTGCATTAGATTTCACCTCGGTTTTAATCTCTGGCAGGCCACTACTCCTCTCAGCTGTCACTGCCTGCTGGCGAGAGAGTTCGAGCGGGTGGGTGTGCTGAGATACAAGGCCATGTTAGACCCACAGCAGTGGAAAGAAGGCTTCTTTGTTCTCCAGAAGTCCAACCTGTTCATATGCCCTGGAAATGATGGAGCCGCCGAGGATATTATAAACCTGAAACGCCTACAGGAGCTCAGTGAGTCTGTTTGTTCAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16286
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 907 1664 16 33
Genomic Location (Zv9):
Chromosome 14 (position 27612571)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26305368
GRCz11 14 26603473
KASP Assay ID:
2260-7601.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTTAAWAAKCTKACTCTTGATGTTTTTCTCAGATTTCGCTACACTTTT[G/T]AACTTTACCTAATGTCTGATAAACTGGTCCAGTTTGGCTTGGAGACTCCA
Long Flanking Sequence:
TTTTATTTTTTATATGTTTTTTATAATAATAATTTAAGTATTATCAATTTTACTGGATTTTTTTTAACACTTTAAAAATATTCAGATGGGCACTTGATTGCAACTTGGTTTTAAACAGCATTACTCTTATTCTTAATACCATAATTTGATGTGAAGCATTCATAAAATGACTGAGTACAAATACTAATACACATTCAGATGTTTCAGTTTTTGTTGTTTGATTGTTTTATTACTCTTTCAGCAGATTTCCAAAAATATTGGTGTTCGGTGGAGAAGTCTATTCTCTTTTATGAGTCTGACAGATGTCATGAGCCCAGTATGAAGATCGATGTTAAAGACATCATCTGTTTAGGAGTCAGCAGGCCAGACTCCAGCAACAACAGCGGCTTTATTGACAAGTGAGAGCCACTGCTAACCAACATCCCTCAGGACATTTAAACATTAAAAAAACTCTTAATAATCTTACTCTTGATGTTTTTCTCAGATTTCGCTACACTTTT[G/T]AACTTTACCTAATGTCTGATAAACTGGTCCAGTTTGGCTTGGAGACTCCAGATGCTTTGCACAGTTGGGCGAGAGCAATAGGGAAGGTAAATATGAATCAGAACTAGCTGTGTTTTATATGCAAAGGAAACAGTCGCATTGGTGCATTAGATTTCACCTCGGTTTTAATCTCTGGCAGGCCACTACTCCTCTCAGCTGTCACTGCCTGCTGGCGAGAGAGTTCGAGCGGGTGGGTGTGCTGAGATACAAGGCCATGTTAGACCCACAGCAGTGGAAAGAAGGCTTCTTTGTTCTCCAGAAGTCCAACCTGTTCATATGCCCTGGAAATGATGGAGCCGCCGAGGATATTATAAACCTGAAACGCCTACAGGAGCTCAGTGAGTCTGTTTGTTCAATCACTGTGACACTGATATGGTGTTTCAGAGAAAAACATGCTGATTAATTTACCCTTGGGGATTAATAAAAGAAATATGTGCTTTTTTGTCTATTCCTTGGGTTAA
Associated Phenotype:
Not determined