Busch Lab

ZMP

LOC100334775

Ensembl ID:
ENSDARG00000076795
Human Orthologue:
LPHN1
Human Description:
latrophilin 1 [Source:HGNC Symbol;Acc:20973]
Mouse Orthologue:
Lphn1
Mouse Description:
latrophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1929461]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa1986 Essential Splice Site F2 line generated Not yet available
sa25716 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25715 Nonsense Mutation detected in F1 DNA Not yet available
sa32807 Nonsense Mutation detected in F1 DNA Not yet available
sa15599 Nonsense Available for shipment Available now
sa38303 Nonsense Mutation detected in F1 DNA Not yet available
sa44519 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa1986
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Essential Splice Site 18 390 1 6
Genomic Location (Zv9):
Chromosome 1 (position 59550841)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58002806
GRCz11 1 58698098
KASP Assay ID:
554-2833.1 (used for ordering genotyping assays)
KASP Sequence:
ATGARGCTCCAGACAGCAGCTCTGACTYTCTCTGCTCTCCTCTGCGCAGG[T/G]CACRCTTTATTTATTCACTCTTTCTGCTCATTATGAWGTTGTGAATATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25716
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Essential Splice Site 67 390 3 6
Genomic Location (Zv9):
Chromosome 1 (position 59546680)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57998645
GRCz11 1 58693937
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCATCCCCTGCTCCTGCTAATACTCCTCTATTATGGCTCTGTCTCTGC[A/T]GTTTTTGTCTGTCCTGGAACACTGGTGCGCGTGCTGGAGCCCAGTTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25715
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 103 390 3 6
Genomic Location (Zv9):
Chromosome 1 (position 59546571)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57998536
GRCz11 1 58693828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGAGGATCATTCGGGGGCGTGGTGTAAAGACCCCCTGCAGGCGGGCGAT[A/T]GACTGTATGTGATGCCCTGGACGCCCTATCGCACCGACATGCTGTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32807
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 126 390 3 6
Genomic Location (Zv9):
Chromosome 1 (position 59546500)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57998465
GRCz11 1 58693757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCCCTATCGCACCGACATGCTGTATGAATACGCCTCCTGGGACGACTA[C/A]ATTCAAAACAGAGTCACCACCACGTATAAGTGAGTTTCACAGTGTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15599
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 135 390 3 6
Genomic Location (Zv9):
Chromosome 1 (position 59546473)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57998438
GRCz11 1 58693730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATACGCCTCCTGGGACGACTACATTCAAAAYAGAGTCACCACCAYGTA[T/A]AAGTGAGYTTCACAGTGTCTRTTTATYCTTTGATYAARTGTAATCAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38303
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 166 390 4 6
Genomic Location (Zv9):
Chromosome 1 (position 59545141)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57997106
GRCz11 1 58692398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGGCGCCGTGTTCTACAATAAGGAGCGAACGCGCAACATAGTGAAATA[T/G]GACCTGCGAACTCGCATCAAGAGCGGCGAAGCTGTTATTGTGAATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44519
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Essential Splice Site 225 390 5 6
Genomic Location (Zv9):
Chromosome 1 (position 59544785)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57996750
GRCz11 1 58692042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGAAGAATAATATAAGCTGAAAAATAAGCTGACTGTCTTGTGTGTGTC[A/G]GGTGAACCCGTACACGCTGCGTTTCGAGGGCACGTGGCAGACCAGTTTCG
Associated Phenotype:
Not determined