Busch Lab

ZMP

cx32.2

Ensembl ID:
ENSDARG00000076789
ZFIN ID:
ZDB-GENE-050303-1
Description:
Gap junction Cx32.2 protein [Source:UniProtKB/Swiss-Prot;Acc:Q7T047]
Human Orthologues:
GJA1, GJA3, GJA4, GJA5, GJA8
Human Descriptions:
gap junction protein, alpha 1, 43kDa [Source:HGNC Symbol;Acc:4274]
gap junction protein, alpha 3, 46kDa [Source:HGNC Symbol;Acc:4277]
gap junction protein, alpha 4, 37kDa [Source:HGNC Symbol;Acc:4278]
gap junction protein, alpha 5, 40kDa [Source:HGNC Symbol;Acc:4279]
gap junction protein, alpha 8, 50kDa [Source:HGNC Symbol;Acc:4281]
Mouse Orthologues:
Gja1, Gja3, Gja4, Gja5, Gja6, Gja8
Mouse Descriptions:
gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]
gap junction protein, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:95714]
gap junction protein, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:95715]
gap junction protein, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:95716]
gap junction protein, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:95717]
gap junction protein, alpha 8 Gene [Source:MGI Symbol;Acc:MGI:99953]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa995 Nonsense Available for shipment Available now
sa17779 Nonsense Available for shipment Available now
sa17698 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa995
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101014 Nonsense 48 277 2 2
ENSDART00000122580 Nonsense 48 277 1 1
Genomic Location (Zv9):
Chromosome 20 (position 40756705)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40827864
GRCz11 20 40724974
KASP Assay ID:
554-0899.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTCCGCATCTTGGTGTTGGGAGCAGGAGCCGAGAATGTTTGGGGCGAC[G/T]AAAGATCCAACTTRGTGTGCAACACCAACACCCCTGGCTGCGATAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17779
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101014 Nonsense 184 277 2 2
ENSDART00000122580 Nonsense 184 277 1 1
ENSDART00000101014 Nonsense 184 277 2 2
ENSDART00000122580 Nonsense 184 277 1 1
Genomic Location (Zv9):
Chromosome 20 (position 40756297)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40827456
GRCz11 20 40724566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTCATCTGTGAAAGGTCACCCTGTATGAGGGCTGAGTGTTTCGTGTCC[A/T]GACCCACGGAGAAAAGCATCTTCATTATCTTCATRCTGGTGGTGGCTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17698
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101014 Nonsense 184 277 2 2
ENSDART00000122580 Nonsense 184 277 1 1
ENSDART00000101014 Nonsense 184 277 2 2
ENSDART00000122580 Nonsense 184 277 1 1
Genomic Location (Zv9):
Chromosome 20 (position 40756297)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40827456
GRCz11 20 40724566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTCATCTGTGAAAGGTCACCCTGTATGAGGGCTGAGTGTTTCGTGTCC[A/T]GACCCACGGAGAAAAGCATCTTCATTATCTTCATRCTGGTGGTGGCTTGC
Associated Phenotype:
Not determined