Busch Lab

ZMP

si:dkey-100g3.2

Ensembl ID:
ENSDARG00000076773
ZFIN ID:
ZDB-GENE-090312-76
Description:
leucine rich repeat containing 58 [Source:RefSeq peptide;Acc:NP_001139094]
Human Orthologue:
LRRC58
Human Description:
leucine rich repeat containing 58 [Source:HGNC Symbol;Acc:26968]
Mouse Orthologue:
Lrrc58
Mouse Description:
leucine rich repeat containing 58 Gene [Source:MGI Symbol;Acc:MGI:2443542]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19568 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19568
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114746 Nonsense 79 351 1 4

The following transcripts of ENSDARG00000076773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47983634)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46795295
GRCz11 1 47486527
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGGATATCAGCAATAACGCGCTCACGGTCATACCAGATGACATTATG[C/T]GATTGAAGAACTTAAAGACGTTTGTTGCAAAGAATAATCTTTTGAACGAG
Long Flanking Sequence:
TCCTGGATGACCAACCATAGAGTGCAGGAGGCGTGACACACACATACACACGCACTCTAGTACAAATAAAAATCCTAAATCAGGCGCGCGCACTTCAGGCAGCAGCACTAAAGGGCATTTTCTAACGTTATAATGTAATATATGTGTACAGATTACACATCAATAACTTGTAGATAACTTTCTTTTACATTGTCGCACCATTAGAAAGTGTGCTGCCTAGCTTTATTTAATTCCCAGTGTTATTTTCCTCTTACTAAACAGTCCATATGGCTCGTTTCCCAAGCGTAGACGACAAGTGTGCAGTTTTACATTTATCCCGTCTGCATCTGGACGACCTGAACTTGGATCATCTGGCGGACAGCAAAAGAAAACAGATCCAGCAGCTTCACCTTACCTACAACCGCCTGACGCTTCTCCCGACTTCTGTCTGCTTTCTGTCCAACCTGGAGTATCTGGATATCAGCAATAACGCGCTCACGGTCATACCAGATGACATTATG[C/T]GATTGAAGAACTTAAAGACGTTTGTTGCAAAGAATAATCTTTTGAACGAGTGCTCGTTTCCGAAGGACTTCGACTGCATTCGTGTGGAGACTCTGAATCTGAGTGGAAACAGGTTTGAGGATATTCCCGCGCAGTTTCTCAAAATGACTACACTACAGTCCCTGTCCCTTGGAGGAAATAGGCTAAAGGCTATTCCTGAAGAAATACAGAACCTGACCAGGTATGAGTTTGTTTTTAGAGTACAAAGTAAGTAGCTGAGCAGGCCAGATTATCTGAATGGTATTCTAATAAATTTGGTGGGAAACGACTTGCAATGAACATCTGTTTTGAAGGGATAGTTCACCCAGAAATGATAATTTACCTCACTGTTTACTCGAGTGGTTCCAAATCTTATGAGTTTCTTTATTTTGCAGAACACAGGAAGATATTTTACTTAAAGCTTATAACCATTGACATTTGATGAAGGAAAAACATGGGTTGCCAGCCCAGCAAACAGTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25655
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114746 Essential Splice Site 195 351 2 4

The following transcripts of ENSDARG00000076773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47987096)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46798757
GRCz11 1 47489989
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGTCCTGTGTGACAATCGCATCCAAAGCGTACCACCCCAGCTCAACAA[G/A]TAAGATCTCCTCTTCCTTCTTTCTAAAGTCAAAGCAGGGTGGTGATTAAA
Long Flanking Sequence:
CTTTGCCTCCCCCTCGAAAGGACTTTCTTTACTTCCTGGTCACATGGAATTACTTTAGGGCGGAGTTATTAGTGGGTGTCTGCTGGGTTTCTGCTCTGAATTTTTCCATCCGTCAATCTTCCTTCAAGTTGTTAGCAACACCCATCTTTTAACAATCTAATTAACTCCCAAAGACGGCAGTCATGCACCACCCTACATTTATTTTCTCTTTTCAGGACCATTTCAAATGGATCTACATCACGATAGTGGACAAAATGACAATCTTCCTTTTCATGTTGACTTTAAGAGTGCAAAAAAAAAAAAAAAAAAAAAAAACAGGACTTGGATTTTCCTTTCATGACTCTTGATATTCTGTCCTCTGTTATGTGCAGTCTAGAGATGCTGTATTTGGGAGGGAACCTCATCTCCTCGATCCCACCTGAGGTGGCTAAACTCACCTGTCTGAGATACCTGGTCCTGTGTGACAATCGCATCCAAAGCGTACCACCCCAGCTCAACAA[G/A]TAAGATCTCCTCTTCCTTCTTTCTAAAGTCAAAGCAGGGTGGTGATTAAAAATAAACGACATCAGATTTCTTTTCTTTGTAGACTACACTCCCTGCTCTCTCTCAGTCTCCACAATAACCTGCTGACCTTCCTGCCTCGTGAGATCCTCAGCCTCGTTCATTTGCAGGAGCTCAGTCTGCGTGGAAACCCTCTGGTGGTGCGCTTCATCAAGGACATGACCTATGACCCTCCGTCTCTGATGGAGCTCGCAGGGCGCACCGTCAAGTCCCAAAACCTTCCGTTCCGCTCGTGTGATCTGCCGGCCAATCTGATCTATTATTTAAACCTGGCTAGCGAATGTCCCAACCCAAAATGTGCAGGTAGGTGTCTTTGACCTTTAAAAAACTTTTAGATACTCCAACTCAATTCAAATTTGGCAAGAATTATGAACCACTAAATCAAGCATTAATAAGCTTTATTAAAATATTTTGCTAAGAGACCACCAGACTGATGTGTAAAA
Associated Phenotype:
Not determined