Busch Lab

ZMP

ddhd2

Ensembl ID:
ENSDARG00000076765
ZFIN ID:
ZDB-GENE-080519-4
Human Orthologue:
DDHD2
Human Description:
DDHD domain containing 2 [Source:HGNC Symbol;Acc:29106]
Mouse Orthologue:
Ddhd2
Mouse Description:
DDHD domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1919358]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15207 Nonsense Available for shipment Available now
sa6168 Nonsense Mutation detected in F1 DNA Not yet available
sa9324 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15207
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114824 Nonsense 458 678 11 17
Genomic Location (Zv9):
Chromosome 10 (position 20589440)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20550854
GRCz11 10 20508235
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAGAAACCATCATGATYCTCAAACCCCYACCACTAGTGCTGTTGAYTA[T/A]CAGCATTTCGATGTGGGCATTGGACAAGTAAGTRTTGGTGTTTAAAACAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2564
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114824 Nonsense 560 678 14 17
Genomic Location (Zv9):
Chromosome 10 (position 20586772)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20548186
GRCz11 10 20505567
KASP Assay ID:
554-3234.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTGAGRCTGATCATGATTAAATGATGTTCACAGAGCTCAAAGAAGGGT[T/A]GACTAGAGTCAGTTCTGATTTACTGGGCTCCTTACGTATGGTTTGGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6168
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114824 Nonsense 605 678 15 17
Genomic Location (Zv9):
Chromosome 10 (position 20586565)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20547979
GRCz11 10 20505360
KASP Assay ID:
554-5474.1 (used for ordering genotyping assays)
KASP Sequence:
CAAGTTTTTAAATGACTCAACTAATATTTGAACATTTGTGCAAAAGCATG[T/A]CCTGTGGAGCAGGAGGACAGCAATGTCAAGGTGGGAATGTTGAATCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9324
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114824 Nonsense 675 678 17 17
Genomic Location (Zv9):
Chromosome 10 (position 20584619)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20546033
GRCz11 10 20503414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCATTCTTCAGATACCAAACACTGTGYCTTTAAGACAGTGTMCAGATCA[C/T]AGCCACCGGGAAGTCTKTTCATTTCCCATTTWTCCGTCTGGAATAGTGCS
Associated Phenotype:
Not determined