Busch Lab

ZMP

si:ch211-234b19.1

Ensembl ID:
ENSDARG00000076757
ZFIN IDs:
ZDB-GENE-070912-219, ZDB-GENE-080220-42
Description:
Zgc:171602 protein [Source:UniProtKB/TrEMBL;Acc:A8WFU5]
Human Orthologue:
EPHB1
Human Description:
EPH receptor B1 [Source:HGNC Symbol;Acc:3392]
Mouse Orthologue:
Ephb1
Mouse Description:
Eph receptor B1 Gene [Source:MGI Symbol;Acc:MGI:1096337]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa33018 Nonsense Mutation detected in F1 DNA Not yet available
sa19866 Essential Splice Site Available for shipment Available now
sa10531 Nonsense Available for shipment Available now
sa16453 Nonsense Available for shipment Available now
sa17732 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33018
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111635 Nonsense 142 229 1 2
ENSDART00000128457 Nonsense 161 985 2 15
ENSDART00000145347 None None 657 None 12
Genomic Location (Zv9):
Chromosome 2 (position 46545110)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 46618746
GRCz11 2 46471350
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACTTTCGAAAAATGGCTTTTATCTGGCATTTCAGGACTATGGGGCATG[C/A]ATGTCCCTGCTTTCAGTACGTGTGTTTTATAAGAAATGCCCCAGTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19866
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111635 None None 229 None 2
ENSDART00000128457 Essential Splice Site 452 985 5 15
ENSDART00000145347 Essential Splice Site 153 657 2 12
Genomic Location (Zv9):
Chromosome 2 (position 46699653)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 46769166
GRCz11 2 46621770
KASP Assay ID:
2259-2615.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCCCAATGGCATTATTCTCGATTATGAGCTGCGCTACTATGAGAAG[G/A]TAAGAGCGTGTGTTTGTGTGTGTGTTGCACTTGAGAGAAAACTGCTCTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25909
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111635 None None 229 None 2
ENSDART00000128457 Essential Splice Site 543 985 8 15
ENSDART00000145347 Essential Splice Site 244 657 5 12
Genomic Location (Zv9):
Chromosome 2 (position 46759226)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 46828739
GRCz11 2 46681343
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATAGCTATGTTTTTAAAATTCTATTGCTTCTTTCTGTCTTTCTCTCAAA[G/A]GAAACGAGCTTACAATAAGGAGGCAGTGTACAGTGACAAACTCCAGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10531
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111635 None None 229 None 2
ENSDART00000128457 Nonsense 611 985 9 15
ENSDART00000145347 Nonsense 291 657 6 12
Genomic Location (Zv9):
Chromosome 2 (position 46772335)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 46841848
GRCz11 2 46694452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGACCCCTTCAYCTATGAAGACCCCAATGAAGYGGTCAGAGAATTTGCC[A/T]AAGAGATCGACGTCTCSACGGTCAAGATYGAGGARGTCATTGGGGCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16453
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111635 None None 229 None 2
ENSDART00000128457 Nonsense 643 985 10 15
ENSDART00000145347 Nonsense 323 657 7 12
Genomic Location (Zv9):
Chromosome 2 (position 46773837)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 46843350
GRCz11 2 46695954
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGTGAGTTTGGGGAGGTTTATAAAGGTCGACTGAAACTCCCTGGAAAA[C/T]GAGAGCTCTACGTTGCCATCAAAACAYTGAAGGCGGGATATTCGGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17732
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111635 None None 229 None 2
ENSDART00000128457 Nonsense 767 985 11 15
ENSDART00000145347 Nonsense 447 657 8 12
Genomic Location (Zv9):
Chromosome 2 (position 46775396)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 46844909
GRCz11 2 46697513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCAACAGCAACCTTGTGTGCAAGGTGTCGGACTTCGGCCTGTCCCGTTA[T/A]CTGCAGGAAGACACMTCTGAYCCCACCTATACYAGCTCACTGGTAAGRCC
Associated Phenotype:
Not determined