Busch Lab

ZMP

slc9a7

Ensembl ID:
ENSDARG00000076754
ZFIN ID:
ZDB-GENE-050913-8
Description:
solute carrier family 9, member 7 [Source:RefSeq peptide;Acc:NP_001025248]
Human Orthologues:
AC013418.1, SLC9A7
Human Descriptions:
HCG2015407cDNA FLJ35312 fis, clone PROST2010545, highly similar to Sodium/hydrogen exchanger 7 [Sour
solute carrier family 9 (sodium/hydrogen exchanger), member 7 [Source:HGNC Symbol;Acc:17123]
Mouse Orthologue:
Slc9a7
Mouse Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 7 Gene [Source:MGI Symbol;Acc:MGI:244453

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33901 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11834 Nonsense Available for shipment Available now
sa33902 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33901
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039934 Essential Splice Site 253 718 5 17
ENSDART00000136585 Essential Splice Site 253 719 5 17
Genomic Location (Zv9):
Chromosome 6 (position 37496992)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37570750
GRCz11 6 37548644
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACACGGACTGTCTGTTTTTTGGTGCCATCATATCTGCCACAGACCCAGG[T/C]ATTTCATCTCTTTCTCCATTTATTTTAATGTCATTGTCTGTTTTTTCATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1590
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039934 Essential Splice Site 288 718 6 17
ENSDART00000136585 Essential Splice Site 288 719 6 17
Genomic Location (Zv9):
Chromosome 6 (position 37497306)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37571064
GRCz11 6 37548958
KASP Assay ID:
554-1532.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTTGGAGAGAGTGTCATGAACGATGCGGTCTCCATAGTGCTTTCATCG[T/C]AAGTCTCTTCTTTAAACWGTATCACTTTCTTGTTCCCATTCTATGCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11834
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039934 Nonsense 358 718 8 17
ENSDART00000136585 Nonsense 358 719 8 17
Genomic Location (Zv9):
Chromosome 6 (position 37499537)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37573295
GRCz11 6 37551189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCACTGTTTTCCTCTACTGGAGACRGCTTTGTTCTTCCTSATGTCCTG[G/A]AGTACTTTTCTACTGGCTGAAGCATGTGGCTTCACAGGTGGGTGGYAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039934 Nonsense 387 718 9 17
ENSDART00000136585 Nonsense 387 719 9 17
Genomic Location (Zv9):
Chromosome 6 (position 37499926)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37573684
GRCz11 6 37551578
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGTTGTCGCTGTGCTGTTTTGTGGAATCACACAAGCTCACTATACCTA[C/A]AACAATCTCTCAGAGGAGTCGACCAAACGCACTAAACAGGTGAATTATTT
Associated Phenotype:
Not determined