Busch Lab

ZMP

syt6a

Ensembl ID:
ENSDARG00000076730
ZFIN ID:
ZDB-GENE-090601-2
Human Orthologue:
SYT6
Human Description:
synaptotagmin VI [Source:HGNC Symbol;Acc:18638]
Mouse Orthologue:
Syt6
Mouse Description:
synaptotagmin VI Gene [Source:MGI Symbol;Acc:MGI:1859544]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37708 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37708
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112493 Nonsense 194 466 2 6
ENSDART00000142171 Nonsense 128 417 3 7
Genomic Location (Zv9):
Chromosome 23 (position 25107167)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24893287
GRCz11 23 24819828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGCAAAGGCGGGAAAAACTGTGGCAAGATCAACTTCTCCCTCCGGTA[C/A]GACTATGAGAACGAAATGCTACTAGTCAAAATTCTCAAAGCTTTTGATCT
Associated Phenotype:
Not determined