Busch Lab

ZMP

RPH3A (1 of 2)

Ensembl ID:
ENSDARG00000076712
Description:
rabphilin 3A homolog (mouse) [Source:HGNC Symbol;Acc:17056]
Human Orthologue:
RPH3A
Human Description:
rabphilin 3A homolog (mouse) [Source:HGNC Symbol;Acc:17056]
Mouse Orthologue:
Rph3a
Mouse Description:
rabphilin 3A Gene [Source:MGI Symbol;Acc:MGI:102788]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21152 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21152
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092674 Nonsense 606 632 18 18
Genomic Location (Zv9):
Chromosome 7 (position 74750899)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72337393
GRCz11 7 72402361
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGCTGCCAGTTGGGAATCACTGCCAAAGGTGAGCGTTTGAAGCACT[G/A]GTACGAATGCCTAAAGAATAAAGACAAGAAGATCGAGCGTTGGCATACTC
Associated Phenotype:
Not determined