Busch Lab

ZMP

LOC559305

Ensembl ID:
ENSDARG00000076701
Human Orthologue:
B4GALNT4
Human Description:
beta-1,4-N-acetyl-galactosaminyl transferase 4 [Source:HGNC Symbol;Acc:26315]
Mouse Orthologue:
B4galnt4
Mouse Description:
beta-1,4-N-acetyl-galactosaminyl transferase 4 Gene [Source:MGI Symbol;Acc:MGI:2652891]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa11710 Essential Splice Site Available for shipment Available now
sa14580 Essential Splice Site Available for shipment Available now
sa41000 Nonsense Mutation detected in F1 DNA Not yet available
sa21055 Nonsense Available for shipment Available now
sa38637 Nonsense Mutation detected in F1 DNA Not yet available
sa21056 Nonsense Available for shipment Available now
sa34171 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11710
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Essential Splice Site 182 1167 5 20
Genomic Location (Zv9):
Chromosome 7 (position 50637025)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48907261
GRCz11 7 49180037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAATTATGGCCTTAGAGTATTTGGATTCATTCATCCTTACAAAGATGG[T/C]CAGTGTATTTCRTCAAGTTTATANTTTTTTTACAAKATTTCATCAAGTATT
Long Flanking Sequence:
CCGTCTCCCAGCTCAGGAAGAATCTTCATTTCCCTCTCTACCCACATGTAAGAGCACAATAAATGTGTCAGACAATAAAAGAACAGACAATTAAGATGAACTTGATTGTGTGACTTGTGAAATGTAGTCTGGCAAATGAAGTCAGTATGTCATTTGCAGTATTTTCATTAACAAAGCCCTAATGTTGTCCGTATATTTGCTCCAGACAGGATGTTCTGCAGACAGAGATTAACATCTGTTTTTTTATAACCTCTGCATTATTGCTAAAGCAATGTTTTGAAACTAGAGCTGTCTTTTTATTCGTCTTAGAAGTCATTTTGAGGTGTGATTCTGTGAATTGCTGTTAGTGCCTTGGGTTTTAGAGTGAATAGACCTGCAGATGCTTTTATATTTAATTCTTCCCCACAGACCAGAACCACAGTGAAGAAAATTGCAGTGGCACCAAAGTGGAAGAATTATGGCCTTAGAGTATTTGGATTCATTCATCCTTACAAAGATGG[T/C]CAGTGTATTTCGTCAAGTTTATATTTTTTTACAAGATTTCATCAAGTATTTTATCAAAAGAATTTAATAAGTGGTTATCATGGCTTAAAAGCTAATTTACTTACTGTATACAGTAGAGTGCCTAACATTAAAGAGTGCATGCTGAAAGATTTGACATAAAATCATCATTCTTCCTCAATGAGTTGTTTGTTCAGATCTGGTTCATTGATTTTAAATTTTATTAGTTGCTGTTTTTTCTTTTGTTACTATTATGAAAAATTCATCTAAGATCATTGTGTGAAAATGAGTACACCCCAACATAAGAAAACATAAAGAAACATAAAAAAAATAAAATAAAGTGGTAATCATGAGGAAAATCTGACAAAATAGCTTTGTATGGAAAATAAATGTCACATAATTAAAAAAAAATATATAAAATAATAATAATATTTTATTTGCCCAAACAGGAATTCAATGATTATAGATTTTGGTTGTACAATTATAGTCTGAGGATTAACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14580
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Essential Splice Site 215 1167 6 20
Genomic Location (Zv9):
Chromosome 7 (position 50646400)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48916636
GRCz11 7 49189412
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCAGAYGAGAGTCCGCTCAATGCCCGGCTYCTGGTGTWYGTGGGACAGG[T/A]GCGTTCTTWAATGCATGACCCTTYAATAAACCKRACCGCACTTCTGAGAY
Long Flanking Sequence:
TTTAAGTTGTATAATTATGCACATTGTTTACATTGACAATTATAAGGGAATGAGTTTACTCTCTTTGTTTGAGTAGAGTCAACAATCTCATTCAAACATGCACAGAGCCAGTTTAGAGAATAACGAAAGAAATAGGCAAAAAAAAAAATCAAAACAAAACACAATTTACATGTGCATGTTAAATCATGGAGGTTGCACCAAATTTGGTCCAATGTGTTATATTGAGTATTGTGGCATCCCCGATGTCTATTAGACATCCTTTAAACACGCCAAAAAATGCGTTTAAGGCTGAGATAAATCAACATTTTATCAAAGCAAACTTGCAAGTGAGAACCTGCAGGTCAGGTCAAAAGGTGATGCAGTACATCTCTGTGAATGTGATAAATTATTTATTTCAGGGGATTTCCAGTTCGCCATAGCGTCAGATGATAACTCTGAACTGTGGCTCAGCTCAGACGAGAGTCCGCTCAATGCCCGGCTCCTGGTGTACGTGGGACAGG[T/A]GCGTTCTTTAATGCATGACCCTTCAATAAACCTGACCGCACTTCTGAGACTTTCCTAGAGCTATCTGTCAGTATGTTTGTCAGTCATGTTCCCAGTCTTGTGCTCTTCTATAGACTTTTACCGGATGTTTACGTCAAAAGACTTTCTGCATTTTGGCTATTAAGTTACAGGACTGTGATTTGGGACAAAATGTGTAAAAACAGGTTTGACCAATTTTTGTCAATCTCAGTGAGTTGAATCTGATCGCAGTCTGTTTACATGTATTGTATACATTGAAATCAGGTTCACATGCATCTGTCTATAATCTGTTGAAAACACTTTAGATTACGTAACAATTCACACTATTTACTACTGGCTTATTACTTGCCTATTATTAAGATAACAGTTAGTACTTATAAATGAAGATACTTTTTTATATCCTTAACTCTGCCCTATACCTAAACCAAATACTTCCTTACTAACTAGCAGCTAATTCGTAGTTTATTGAGCTAAAAGTCTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3630
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Nonsense 311 1167 10 20
Genomic Location (Zv9):
Chromosome 7 (position 50703450)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48973686
GRCz11 7 49246462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGCGTACATCACATCCCACAGACACTGGCCAGTCACTCTCTCGCTCTG[C/T]AGATCTACCACAGGACAGAGACACACACTGCAGACATGCTCAAACCAGAC
Long Flanking Sequence:
CACCCACACAAACACGGGGAGAACATGCAAACTCCACACAGAAATGTCAACTGATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTACTTTTTTCTATTGGAGTACAAGATTATCATTGTGATGTGTTTGAAAACATGAGCAGCAGGTTTTGTTTACACTTGTGCAGTTCAGATAGAGTGGGATTTTTGGACCCTATAGTGTATATACAGTTCATGATGCTTCACTTATTTTCCACCCATAGACGAGCAGCGATGCTGCCATTTCTGCATTGCCAACAGCAGAAGTTGTTGAATGCTAGTCTGTAGGCTGATTTAAATTCACATGCTGTCTCTCATTGTCCTCAATCCTCCATCTCTCTCTTCTCTGTGTCTGTCAGATGAGTCCAGTCTAAAGATGAACAGCGTACATCACATCCCACAGACACTGGCCAGTCACTCTCTCGCTCTG[C/T]AGATCTACCACAGGACAGAGACACACACTGCAGACATGCTCAAACCAGACCCAAGAGACACCTTCTACAAGAGTGAGTACTGTACAGACATTTAACCCTCAGCATCTCAGTAGAAATGTTTCCATCAACCTGTTTTAATGTGCATTTAGAAGTTTCTCATGCAAAACAAGTTATGGAAACACATGAATTATCTTATTATATTATATTTTTATTTTTGCAAAAAAAAAAAGAAAAAAAAAGAGTTAAAACAAATCATTGGAGATAGAAATGCATTTCTTAAATAAACTCACCATACACTCACCGGCCACTTTATTAGGTACACCTTACTCGTACCAGGTTGGACCCCCCTTTAGAACTGCCTTAATCCTTTATGGCATAGATTCTACAAGGTACTGGAAATATTCCTCAGAGATTTTGGTCCATATTGACATGATAGCATCACACAGTTTCTGCAGATTTATTGGCTGCACATCCATGATATCAATCTAATAAAATGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41000
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Nonsense 376 1167 12 20
Genomic Location (Zv9):
Chromosome 7 (position 50711426)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48981662
GRCz11 7 49254438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGTATATCATCATATTTTGTTTTATATTTCTAGGTCTACCTTTCCTA[T/G]GTGTATCCCAATGACTTCACCAGACTTACTCATATGGAGAAAACCAACAA
Long Flanking Sequence:
TATTGCTGAGCTACAAAAAAGTAAACTAGAATTTAATGTTTCGATTAAATGTAAATGAATCTTATATATATATATTTATTATATTATATATTATTATATTATTATATTATATTTATTTATTTATTTATTTTTACTTATTTATTTATTTATTTTTTGAAGAATAGAGGACTATAGAAGACATCGGCAATCAAATCAAGGCAAAAACTAGTGTAATTGTTTTATAAATTATATAATTATAAATCGTGTTATAAATGAAATTGTTTTGTTTTTTTTATAATAAGTTTATTATTAAATGTAAACATGTATTAGTTAATACAAGGCAATGTTTTCTAGCAATTTTTAAACATTAATAAATAAACTAGGAATTTACCCAATTATATTTAACTTTGACCCACTAGCCTCAATCAAGATTCGTTTTTGGCCCTTCATAAGGAAAATTTTGGGCACCCCTGATGTATATCATCATATTTTGTTTTATATTTCTAGGTCTACCTTTCCTA[T/G]GTGTATCCCAATGACTTCACCAGACTTACTCATATGGAGAAAACCAACAAATGCTTCTACCGAGAGTCTCCGGTCTACTTGGAGAAGTATGAATCCAAACTGATCCTGACAAGAAAGTATTCAACATCTAAATACATAACTGAACACATACATATACATATGGTCACTCTTTTGAACTGTCATTTAGATTTGGCTTCTATAAATACATGAAGATGGATGAGGAGGAGGATGACCAGCCTGTTTTCTTCCCCAAACCCGATGGTCTGTGTTCAGCTGGGATCTTAATAACAGATAAGAATTCAGCAGCTGTTTGCTCTCTTTAAAACCTCATCATGAAATTTGTAATGAGCCAGGCAACATATGTGTTCCCAGGGTTCAAATCTAACACACACCAGACACCAAATGTGAGCAGAAATGGCCTTTGAGGAGTAAATAAACAGTTGGCTGTTACCTTTATTAAGACCATTACGTGGATTAGGTTGCAGTATTACAAAGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21055
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Nonsense 378 1167 12 20
Genomic Location (Zv9):
Chromosome 7 (position 50711432)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48981668
GRCz11 7 49254444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATCATCATATTTTGTTTTATATTTCTAGGTCTACCTTTCCTATGTGTA[T/A]CCCAATGACTTCACCAGACTTACTCATATGGAGAAAACCAACAAATGCTT
Long Flanking Sequence:
TGAGCTACAAAAAAGTAAACTAGAATTTAATGTTTCGATTAAATGTAAATGAATCTTATATATATATATTTATTATATTATATATTATTATATTATTATATTATATTTATTTATTTATTTATTTTTACTTATTTATTTATTTATTTTTTGAAGAATAGAGGACTATAGAAGACATCGGCAATCAAATCAAGGCAAAAACTAGTGTAATTGTTTTATAAATTATATAATTATAAATCGTGTTATAAATGAAATTGTTTTGTTTTTTTTATAATAAGTTTATTATTAAATGTAAACATGTATTAGTTAATACAAGGCAATGTTTTCTAGCAATTTTTAAACATTAATAAATAAACTAGGAATTTACCCAATTATATTTAACTTTGACCCACTAGCCTCAATCAAGATTCGTTTTTGGCCCTTCATAAGGAAAATTTTGGGCACCCCTGATGTATATCATCATATTTTGTTTTATATTTCTAGGTCTACCTTTCCTATGTGTA[T/A]CCCAATGACTTCACCAGACTTACTCATATGGAGAAAACCAACAAATGCTTCTACCGAGAGTCTCCGGTCTACTTGGAGAAGTATGAATCCAAACTGATCCTGACAAGAAAGTATTCAACATCTAAATACATAACTGAACACATACATATACATATGGTCACTCTTTTGAACTGTCATTTAGATTTGGCTTCTATAAATACATGAAGATGGATGAGGAGGAGGATGACCAGCCTGTTTTCTTCCCCAAACCCGATGGTCTGTGTTCAGCTGGGATCTTAATAACAGATAAGAATTCAGCAGCTGTTTGCTCTCTTTAAAACCTCATCATGAAATTTGTAATGAGCCAGGCAACATATGTGTTCCCAGGGTTCAAATCTAACACACACCAGACACCAAATGTGAGCAGAAATGGCCTTTGAGGAGTAAATAAACAGTTGGCTGTTACCTTTATTAAGACCATTACGTGGATTAGGTTGCAGTATTACAAAGATGCCATTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38637
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Nonsense 453 1167 14 20
Genomic Location (Zv9):
Chromosome 7 (position 50714137)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48984373
GRCz11 7 49257149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGTGTCGACCCAGAGGAGGCAATCAATTCCAGCAACCGGCCAGTCAAG[A/T]GAAGCGGCCCGTCCTATCAGACATCAAGGATTACAGCAGCCACCGCCTCC
Long Flanking Sequence:
ATCAATTTTACTGTTAGAAAGGCAAATGGAGATGGATTTGAGTAAAGAAACAACAACAACAATAAAAACTCTTAACAAAAACAAACGTGAATTAATGCAAAATGATTTATTAACAGGAATTAACAAAAAAATGAACAGTTCCATAACCTGTGAACTAATACAGGTATGTGGAGAATTGTCTCAGTTTTCCAGTCTTATTGGCCTGAGTGTTTATTTTTGAGCCTTGCTGTGTCTGCCTTTTGACAGCTGCAACATGTTGAATGCTAACTGCGCGTCTGACAGCCCTAAAGATGATAATGATAAGCTGTAGATTTCTATCAACACTGCACCAGCATCACCGACTCTTTAATCAAGTCATTAAGCAATTCTCATTTCAGATTGCATGAGTTATTTAAAAGGCTTTGGTTTGATGAGGCTTGTCTCTTCTGACAGATTTCCTGGAGGAGGAAGAGGGTGTCGACCCAGAGGAGGCAATCAATTCCAGCAACCGGCCAGTCAAG[A/T]GAAGCGGCCCGTCCTATCAGACATCAAGGATTACAGCAGCCACCGCCTCCTCAAAGCCTGATAGATTAGACGGGGGTTCAAAGAGCTCCGTCTTTCAGCAAGAGAAGCAGTACGTTCAGTTTAAAGAGCAAGAGAGGAGTAAAAAAAGAACGAAAGGGGAAAGGTTTTATAGACACTCTCAGGTGGTGGATGATGAAATGACAGAAATAAGACAGGTGAAAGGGAGTACAGGTGTGCTAGAGTCTCAAAGCGGCTCTCTAAATGAACAGACGGGACCAAGTGAGGAAAATGGGGACTCCCAAACACTTTCTCTGGTTCAGAGAGGGCGTTCTTTGGCATGGGTGCTGCCTGACCCTGCACTGCAGAGCGAAAGTAAACTGATTGAAACTGCCAGCCCAACTGTGAAAGAAAGATCTCCCTTTAAGCTTCCTCATCTCTATGTCCTGGCTAATAGGATTTTAGGTAACGCAGGTAAGCCTGTGGTGGAGAAAGAATCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21056
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Nonsense 566 1167 14 20
Genomic Location (Zv9):
Chromosome 7 (position 50714478)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48984714
GRCz11 7 49257490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGGACTCCCAAACACTTTCTCTGGTTCAGAGAGGGCGTTCTTTGGCATG[G/A]GTGCTGCCTGACCCTGCACTGCAGAGCGAAAGTAAACTGATTGAAACTGC
Long Flanking Sequence:
CTCTTTAATCAAGTCATTAAGCAATTCTCATTTCAGATTGCATGAGTTATTTAAAAGGCTTTGGTTTGATGAGGCTTGTCTCTTCTGACAGATTTCCTGGAGGAGGAAGAGGGTGTCGACCCAGAGGAGGCAATCAATTCCAGCAACCGGCCAGTCAAGAGAAGCGGCCCGTCCTATCAGACATCAAGGATTACAGCAGCCACCGCCTCCTCAAAGCCTGATAGATTAGACGGGGGTTCAAAGAGCTCCGTCTTTCAGCAAGAGAAGCAGTACGTTCAGTTTAAAGAGCAAGAGAGGAGTAAAAAAAGAACGAAAGGGGAAAGGTTTTATAGACACTCTCAGGTGGTGGATGATGAAATGACAGAAATAAGACAGGTGAAAGGGAGTACAGGTGTGCTAGAGTCTCAAAGCGGCTCTCTAAATGAACAGACGGGACCAAGTGAGGAAAATGGGGACTCCCAAACACTTTCTCTGGTTCAGAGAGGGCGTTCTTTGGCATG[G/A]GTGCTGCCTGACCCTGCACTGCAGAGCGAAAGTAAACTGATTGAAACTGCCAGCCCAACTGTGAAAGAAAGATCTCCCTTTAAGCTTCCTCATCTCTATGTCCTGGCTAATAGGATTTTAGGTAACGCAGGTAAGCCTGTGGTGGAGAAAGAATCTAATAGCAATAAAATTTACATTACAAGACCTCGTCCGCCAGTAAGCAGACCCAAACCTCCTGTGGAAGTGTTTCCCGGGGTCTTTCTTTACCAATCTAGGAAGTCCAAGAGGCTTGTGGATTTGAGTTCAAAATGGAGGTCCTTAAAAACACAAGCTGCTGCTTCTGCCCCCTGGGCGAACTTCCCCTTAATGGACCACAAGACTTCCACCCAATCTGCCCTGTTAAAGCAAAGCCATCTCTCCTCGCCCACAGAGCCTGGGCCTCATAATAAGGGTGACCCTACAGCCTCCATATCAGATCCAGACAGCGTGCCCCCATCAAGCTCAGAAAAAAGAGACCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34171
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Nonsense 1063 1167 18 20
Genomic Location (Zv9):
Chromosome 7 (position 50726250)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48996486
GRCz11 7 49269262
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCACATTCACTTCCCTCACAACATCCTGGAGAGCATCAGGAAGCACTG[T/A]GTTGAGGGCAGACTGGCCTTTGCACCCATCGTCATGAGACTGGACTGTGG
Long Flanking Sequence:
ACGAAATTGTTGACATTTTTGCAGATTTATAAAAAAAAAAAAAGAAAAACTGAAATATCACATGGTCAGACCCTTTGCTGTATGACACTAATGTAATTCAGGTGCTGTCCGTTACTTCTGATCATCCATGGGATGGTTCTACACCTTCATTTGAATTGACTGATTGGACTTGACAGCTTACAATGACCTTATAGCTCATAATGCTATTTATTTATTTAAACACACTAACAAGAACTCGCAATGTTATAAAATGTTTTTTTTTATGTTGTCAGGAAGTAAGTTTTTTCTTTACATTGTTTGTACTATTTGAAACATGCTGATGCTGTAACTGTGAACTGTAAAGTGATTTGTGGTCTACAATATGTATTTCTTTGTTCATTACTAAAATACTAGTATAAAACATCTTCCATGGGATTTCAGGACAGTCACAGCATAGTGTTCCTGTGTGACCTGCACATTCACTTCCCTCACAACATCCTGGAGAGCATCAGGAAGCACTG[T/A]GTTGAGGGCAGACTGGCCTTTGCACCCATCGTCATGAGACTGGACTGTGGGAGCTCGCCTCTGGAGCCTGATGGTAAAACATACATTATCTATTGATGATAAGCAATAAACACTTACTTACTTACTTACTTACTTACTTACTTACTTACTCCCAGGGTTGTTTATTTCGAAGTTGATATACATCTAATTTTTATGAGGTGGATTGTTAGCCCAACGCTCAACCCCCAACCTGGAGGACCAGGACACACACACATACACTACGGACAATTTAGCTTACCCATTTCACCTATAGCGCATGTCTTTGGACTTGTAGGGGAAACCAGAGCACACAAAGAAAACCCATGCCAACACCGGAGAACATGCAAACACAGAAATGCCAACTGACCTTTTTACTGTGAGGCGAAAACTCTACCCACTGCAAACACCATACTCCTCCAAACACTTACAGCATACAGCAGCATATATACAAATACAAATTTAGTTTGAATGTTTCTTTCACA
Associated Phenotype:
Not determined