Busch Lab

ZMP

si:ch211-212n6.8

Ensembl ID:
ENSDARG00000076693
ZFIN ID:
ZDB-GENE-081105-90
Description:
hypothetical protein LOC561929 [Source:RefSeq peptide;Acc:NP_001092713]
Human Orthologues:
CRYGA, CRYGB, CRYGC, CRYGD
Human Descriptions:
crystallin, gamma A [Source:HGNC Symbol;Acc:2408]
crystallin, gamma B [Source:HGNC Symbol;Acc:2409]
crystallin, gamma C [Source:HGNC Symbol;Acc:2410]
crystallin, gamma D [Source:HGNC Symbol;Acc:2411]
Mouse Orthologues:
Cryga, Crygb, Crygc, Crygd, Cryge, Crygf
Mouse Descriptions:
crystallin, gamma A Gene [Source:MGI Symbol;Acc:MGI:88521]
crystallin, gamma B Gene [Source:MGI Symbol;Acc:MGI:88522]
crystallin, gamma C Gene [Source:MGI Symbol;Acc:MGI:88523]
crystallin, gamma D Gene [Source:MGI Symbol;Acc:MGI:88524]
crystallin, gamma E Gene [Source:MGI Symbol;Acc:MGI:88525]
crystallin, gamma F Gene [Source:MGI Symbol;Acc:MGI:88526]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa34623 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34623
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132890 Nonsense 36 173 2 3

The following transcripts of ENSDARG00000076693 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23221082)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22376868
GRCz11 9 22187737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTGACTGTGGTGACTTCTCCTCCTACATGAGCCGCTGTCACTCTTGC[A/T]GAGTGGACAGTGGTTGCTGGATGATGTACGATCAGCCCAACTACATGGGA
Associated Phenotype:
Not determined