Busch Lab

ZMP

A3KP79_DANRE

Ensembl ID:
ENSDARG00000076651
Description:
LOC571837 protein [Source:UniProtKB/TrEMBL;Acc:A3KP79]
Human Orthologues:
DYSFIP1, NRARP, PPP1R12A, PPP1R12B, PPP1R12C
Human Descriptions:
NOTCH-regulated ankyrin repeat protein [Source:HGNC Symbol;Acc:33843]
dysferlin interacting protein 1 [Source:HGNC Symbol;Acc:16813]
protein phosphatase 1, regulatory (inhibitor) subunit 12A [Source:HGNC Symbol;Acc:7618]
protein phosphatase 1, regulatory (inhibitor) subunit 12B [Source:HGNC Symbol;Acc:7619]
protein phosphatase 1, regulatory (inhibitor) subunit 12C [Source:HGNC Symbol;Acc:14947]
Mouse Orthologues:
Dysfip1, Nrarp, Ppp1r12a, Ppp1r12b, Ppp1r12c
Mouse Descriptions:
Notch-regulated ankyrin repeat protein Gene [Source:MGI Symbol;Acc:MGI:1914372]
dysferlin interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1915951]
protein phosphatase 1, regulatory (inhibitor) subunit 12A Gene [Source:MGI Symbol;Acc:MGI:1309528]
protein phosphatase 1, regulatory (inhibitor) subunit 12B Gene [Source:MGI Symbol;Acc:MGI:1916417]
protein phosphatase 1, regulatory (inhibitor) subunit 12C Gene [Source:MGI Symbol;Acc:MGI:1924258]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17726 Essential Splice Site Available for shipment Available now
sa45843 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17726
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110598 Essential Splice Site 152 240 4 13
ENSDART00000122282 Essential Splice Site 154 242 3 12
Genomic Location (Zv9):
Chromosome 25 (position 5170520)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4477215
GRCz11 25 4603742
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTATAATCACGCATGTCAAGCATTTRGTATCCATGTGACCCTCTGCCTC[A/T]GGGTGCTGTTGAAGTGTGGGATAGAYGTGGACAGTCGGGACAGTGACGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45843
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110598 Essential Splice Site None 240 7 13
ENSDART00000122282 Essential Splice Site None 242 6 12
Genomic Location (Zv9):
Chromosome 25 (position 5174596)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4481291
GRCz11 25 4607818
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGTAACAAGCTCTGTGACCAGCAGCGGTCCAAACCAGGTTAAAAAGG[T/G]GAACAAATAACTACTTTCAAGCATCCAGTTTTATGAAATGTTGACAGTTT
Associated Phenotype:
Not determined