Busch Lab

ZMP

si:ch211-241o7.4

Ensembl ID:
ENSDARG00000076644
ZFIN ID:
ZDB-GENE-091117-27
Description:
LOC567267 protein [Source:UniProtKB/TrEMBL;Acc:A5PLH3]
Human Orthologue:
KCNV2
Human Description:
potassium channel, subfamily V, member 2 [Source:HGNC Symbol;Acc:19698]
Mouse Orthologue:
Kcnv2
Mouse Description:
potassium channel, subfamily V, member 2 Gene [Source:MGI Symbol;Acc:MGI:2670981]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31769 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27579
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111073 None None 436 None 2
ENSDART00000136239 Nonsense 43 518 1 2
Genomic Location (Zv9):
Chromosome 10 (position 15339513)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15352820
GRCz11 10 15310939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGAGGACTCTGACCTTCCTTTTGGTCAGCACAATTGGGTTAAACCATG[G/A]AATTCGATGCAGGAGTTAAGTAAGGATATTTACGACATCTATGCAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31769
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111073 Nonsense 327 436 1 2
ENSDART00000136239 Nonsense 409 518 1 2
Genomic Location (Zv9):
Chromosome 10 (position 15340610)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15353917
GRCz11 10 15312036
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTACCAACAAGTGGGCTGTCTGTTCCTCTTCATTGCAATGGGAATCT[T/A]AACATTTTCGGCCATGGTGTATACCGTCGAGCATGATGTGCATAAAACAA
Associated Phenotype:
Not determined