Busch Lab

ZMP

si:ch211-117n7.1

Ensembl ID:
ENSDARG00000076595
ZFIN ID:
ZDB-GENE-060503-381
Description:
Semaphorin 4g [Source:UniProtKB/TrEMBL;Acc:B6E510]
Human Orthologue:
SEMA4G
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4g
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45482 Nonsense Mutation detected in F1 DNA Not yet available
sa42144 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22232 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45482
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111365 Nonsense 21 839 1 14

The following transcripts of ENSDARG00000076595 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 9090743)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9393363
GRCz11 13 9725386
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTTGCAGGCGCTTCAGAGGCCTGACACTGAACTACAGTTTGCTGCTGT[T/A]GGAGGAGGACGCAGACCTGCTGTACGTGGGAGCTCGAGGGGCTTTATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42144
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111365 Essential Splice Site 305 839 8 14

The following transcripts of ENSDARG00000076595 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 9105542)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9408162
GRCz11 13 9740185
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCCAGCTCTCAGGACTCTGCTTTCTATGGCATATTTGGCTTGGAATGG[T/C]AAGAGCACTTTTTCTTTTAATGTTTGTTTTGCATTATTGGCTATGTGAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4492
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111365 Nonsense 640 839 14 14

The following transcripts of ENSDARG00000076595 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 9124713)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9427333
GRCz11 13 9759356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTGACAGTTCGCCAAGAGCTTCCAGTGCCTCCTCCTGTAAAGCCAACA[C/T]AACCACGCTTCACCACAGAAATCTATTGGACCAGTCAGTCTTCCCAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22232
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111365 Nonsense 655 839 14 14

The following transcripts of ENSDARG00000076595 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 9124758)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9427378
GRCz11 13 9759401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACACAACCACGCTTCACCACAGAAATCTATTGGACCAGTCAGTCTTCC[C/T]AAAGCGACTCCGAGGAAGACTTCGACCCCACCCCGATGTCTCCTCGCTTC
Associated Phenotype:
Not determined