Busch Lab

ZMP

crygm2d7

Ensembl ID:
ENSDARG00000076572
ZFIN ID:
ZDB-GENE-060918-5
Description:
crystallin, gamma M2d7 [Source:RefSeq peptide;Acc:NP_001038572]
Human Orthologues:
CRYGA, CRYGB, CRYGC, CRYGD
Human Descriptions:
crystallin, gamma A [Source:HGNC Symbol;Acc:2408]
crystallin, gamma B [Source:HGNC Symbol;Acc:2409]
crystallin, gamma C [Source:HGNC Symbol;Acc:2410]
crystallin, gamma D [Source:HGNC Symbol;Acc:2411]
Mouse Orthologues:
Cryga, Crygb, Crygc, Crygd, Cryge, Crygf
Mouse Descriptions:
crystallin, gamma A Gene [Source:MGI Symbol;Acc:MGI:88521]
crystallin, gamma B Gene [Source:MGI Symbol;Acc:MGI:88522]
crystallin, gamma C Gene [Source:MGI Symbol;Acc:MGI:88523]
crystallin, gamma D Gene [Source:MGI Symbol;Acc:MGI:88524]
crystallin, gamma E Gene [Source:MGI Symbol;Acc:MGI:88525]
crystallin, gamma F Gene [Source:MGI Symbol;Acc:MGI:88526]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8656 Essential Splice Site Available for shipment Available now
sa9600 Essential Splice Site Available for shipment Available now
sa25425 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8656
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113174 Essential Splice Site 2 173 1 3
ENSDART00000113174 Essential Splice Site 2 173 1 3

The following transcripts of ENSDARG00000076572 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23305352)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22461138
GRCz11 9 22272007
KASP Assay ID:
2260-1775.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCTTCTCCCTTGTGAAACCACTGAGAATAATCCARTGCAAACATGAAG[G/A]TAAATCTCATTCTATYACCCACTCCAAACAGTAAAACTAAAATGATAWAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9600
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113174 Essential Splice Site 2 173 1 3
ENSDART00000113174 Essential Splice Site 2 173 1 3

The following transcripts of ENSDARG00000076572 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23305352)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22461138
GRCz11 9 22272007
KASP Assay ID:
2260-1775.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCTTCTCCCTTGTGAAACCACTGAGAATAATCCARTGCAAACATGAAG[G/A]TAAATCTCATTCTATYACCCACTCCAAACAGTAAAACTAAAATGATAWAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25425
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113174 Nonsense 89 173 3 3

The following transcripts of ENSDARG00000076572 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23304888)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22460674
GRCz11 9 22271543
KASP Assay ID:
554-7654.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATAAACTTGAAAATGATGAACTCTTCCACTACAGCACAGGGGATCCTAC[A/T]GAATGAGGATCTATGAGAGGGAGAACTTCGGAGGTCAGATGTACGAGATG
Associated Phenotype:
Not determined