Busch Lab

ZMP

RB1CC1

Ensembl ID:
ENSDARG00000076559
Description:
RB1-inducible coiled-coil 1 [Source:HGNC Symbol;Acc:15574]
Human Orthologue:
RB1CC1
Human Description:
RB1-inducible coiled-coil 1 [Source:HGNC Symbol;Acc:15574]
Mouse Orthologue:
Rb1cc1
Mouse Description:
RB1-inducible coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1341850]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa37934 Nonsense Available for shipment Available now
sa44173 Nonsense Mutation detected in F1 DNA Not yet available
sa24535 Nonsense Available for shipment Available now
sa24536 Splice Site, Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5083
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 65 1625 2 22
Genomic Location (Zv9):
Chromosome 24 (position 36466857)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35085772
GRCz11 24 34972037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGAGGGGAATGTATGGTGGCAGAGAGGCGGGTGTGCAGCTACAGCGCT[G/T]GAACAGTGAGTAACAAGCAAAATCACACCACAACAGTGCTTATTTAGAGA
Long Flanking Sequence:
CCTAGGTATGCCTTTAAATGTCACTTTAAGTATAGAAGTGTCTTGAAAATATCTAGTAAAATATTATTTACTGTCATCATGGCAAAGATAAAATAAATCTGTTATTAGAAATGAGTTAATAAAACTATTATCTTTAAAAATATGTTAAAAAAATGTCTCTCCGTTAAACAGAAACAGAGGAAAAAAATAGACGGGGCTAATAATTCTGACTTCCACTTTGTTTATTATTTATTGTTACTAGTCTCTGAAAAGTCACATTTTTTCATCGTTTCTCTGTACTCAGTTTGTCTGTAGATTTGCTTGTTAATTAAGCTGTGATTTGTTTTATTGGTCGACTAAAATGTAATGTGTTGTGCTTTATGCTCTTTTTGTTTTTTAGTGTTTTGGACCTTAAACATGCCATTCAGGCCAAATATAAAATTGCAATCCAGCACCAAGTGCTGGTGGTCAATGGAGGGGAATGTATGGTGGCAGAGAGGCGGGTGTGCAGCTACAGCGCT[G/T]GAACAGTGAGTAACAAGCAAAATCACACCACAACAGTGCTTATTTAGAGAGTAGTGTATAGTTTCATATTTACCAAAAAAAAAATTCTCAATATTTTGGGAGACCTTTTAATAACCATATTTAAGCAATATATTTGCTTCTTGTTTTTGTGCTGGTGCCTTTGACTGATTTGGCTTGTTGTGGATAAAGAATATCACACTGAAGATTGCTCTGAGATAACAGAATTTAAAAGCATACAAAATAAAGTATTGATGTATCTGAAATTTAACTGACTGGATAATAAATAGCTAATTCATTAATACATTTGAGATTCCATAAAGGCTCTATTGCTTGTGCAATATTAAGTAACTAAATACAAAACCCATGAAAGGATATTTCTGACCTTCATAACTTGAATTTTGAAAGGTCATTCTACCATCCACGTCCTTATAGACGTATAGACATAAAAGATTTTTGTTTGTTATTTGCAAAATTGAGTGAAATACACTACTGTCATCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37934
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 512 1625 8 22
Genomic Location (Zv9):
Chromosome 24 (position 36477392)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35096307
GRCz11 24 34982572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTTGCTGTAGTGGAGGTGGTCCGGCGCAAAATGTTCATAGGACACTA[C/A]AGACAAGTAAGAATCTGCTGCTTTACTTTGTGTGATTATAGGGAATGGAT
Long Flanking Sequence:
TTATGAAACTGAAAATAGTCACATCAATCGTTCACCAGATTAAAATTGTTTTAAAACATAACATTACCTGTCTAAAAGAAATACTTCAGCCATGGTATCGTCCTTCCTCCAGCATGCAAAAGTATCTCCAATATTGATTCAGGATTTAAAAAAATTTGGATTATTATCTACTATTATCTTTAGAAATGTGCAGAAAAATTATTCTGTTAGACAGAAACTGGGAAAATATACAAGGCAGCTAATGCTTCAGGAGGACTAATAATTCTGACTTTAACATTATATGTCATTTGCTAATTGGATTATGGTGTCTTCTCCATTAGATGGTGCTGCTACGTGATGCTTCACGCTGATCAGGATGGAGAGAAACTGCAGGCTCTCCTGAGGCTGCTGACGGAGCTGCTGGAGCGCGTGCGGGTTGTGGAGGCGCTCAGTACTGTGCCACAGATGTACTGTCTTGCTGTAGTGGAGGTGGTCCGGCGCAAAATGTTCATAGGACACTA[C/A]AGACAAGTAAGAATCTGCTGCTTTACTTTGTGTGATTATAGGGAATGGATGTAATGCACACTGGGGTTTTTAAAGCTGAGTCAATATGAGCTACATTAACAATATTGGTACTGTTGTAGATTTTTTTATTCTATCTCAGAAAACTAACTTGCTCTTTATTTATTGTTTTTTCCAGTGGGCGAATGCTCTTGTCAAAGATGGAAAAAACCTCTATGAGGCGGAAAAAGTAAAAAGGGAAACCTTTGGAAAGCTATTCAGTAAGTTCTTGGTTGGCTTCTTTAAGTTTTGGAACAAAGATGGACAACTCAGTTAGGGGGTGTGTGTTATAAAATCTATTTTTTTTCTAATTAAAGAATAGGATATAGGTTTAGAATAACTAGCTAGGTTTCCATCACTCTGTGTTAATACCTGTTTTGAAGTATTGAATTAGAGAAAAGTAATGGAAACAAAAACCTTTTAAAAAAAAATAATAAAAAATTCACTAAAAAGTTTTTAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44173
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 831 1625 13 22
Genomic Location (Zv9):
Chromosome 24 (position 36480607)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35099522
GRCz11 24 34985787
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGAAAAGTTAAAGAAGACCTTTATCATTTTCGAGGTCTTGTTCTGAAA[G/T]AGCAACGGGACTTTGGATTCGCCCTGAAAACAATGACCACTGAGGTCCAT
Long Flanking Sequence:
CCTCTACCTCCACCAAAACTTTGTCCACTCTTAGTTTAAAAGCACCGGACTGCCAACCCTTGGCGCTTCCTGGTCCACTGGAGGACCTGTCACCCGACAGCATAGATGCCCAGACTTTTGATTTTGAAACTATTGGCCATCCCAGCATGGATCCTGTATTACAGCAAGGCTCATTGGACTTGGATTCATTGGCAGAAAGTCCTGAGTCTGACTTTATGTCCGCAGTTAATGAGTTTGTTATTGAGGAGAATTTGCTGTCACCTAATCCTATTAGCGATCCCACAAGCCCAGAGATGATGGTGGAGTCTCTCTACTCCTCCGTCATAAATGCAATTGATAGCAAACGCATCCAGGACACTACCACCCTGGAGAAGGAAAATTCAAAGATTGCTGCGATCAAGCTATCAGCAGACAGGTATCGTTCTGCTGCCGAAGAGTCCCAGAACAATTTGAGAAAAGTTAAAGAAGACCTTTATCATTTTCGAGGTCTTGTTCTGAAA[G/T]AGCAACGGGACTTTGGATTCGCCCTGAAAACAATGACCACTGAGGTCCATAATGCTCTCAGTAATGTCAGTTACTCTCATGAAGAGGAGCTAAAAGAAACACAACAAACCCATCTCCAGAGTTTAAAAGAGGACCATGAAAAGCAGATACGAACACTGACAGAAGAGCTGGAGGGCAACCAGAAGATAGTCAAAGATGTCCAGAGAGCAATGCTGGAGTTGGAGGGGCTTGTGGAGCGCAAGGAAAAGGAAATATATCAGCTGGAAAGTGAGAGGGAAAGATCTACGCAAGAACTGCAAGATCTTCACAAGCAAGCTGTGCAAAACCTTGAAGAGAAGATCTTAAAGCAAAGCGAAGAACTCAAATCTGCATTGCTGTCCAAGGATGAACTCGCTGGGCAATTGGAGAAGCTTCACTTTGAGATTGAGCATGGCCAGCAGAAAATCAGACAGGAGATGAAGAATGCTGAGAAGGTGCATCTTCAGGAACTGGAGACACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24535
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 866 1625 13 22
Genomic Location (Zv9):
Chromosome 24 (position 36480712)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35099627
GRCz11 24 34985892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCAGTAATGTCAGTTACTCTCATGAAGAGGAGCTAAAAGAAACACAA[C/T]AAACCCATCTCCAGAGTTTAAAAGAGGACCATGAAAAGCAGATACGAACA
Long Flanking Sequence:
ATGCCCAGACTTTTGATTTTGAAACTATTGGCCATCCCAGCATGGATCCTGTATTACAGCAAGGCTCATTGGACTTGGATTCATTGGCAGAAAGTCCTGAGTCTGACTTTATGTCCGCAGTTAATGAGTTTGTTATTGAGGAGAATTTGCTGTCACCTAATCCTATTAGCGATCCCACAAGCCCAGAGATGATGGTGGAGTCTCTCTACTCCTCCGTCATAAATGCAATTGATAGCAAACGCATCCAGGACACTACCACCCTGGAGAAGGAAAATTCAAAGATTGCTGCGATCAAGCTATCAGCAGACAGGTATCGTTCTGCTGCCGAAGAGTCCCAGAACAATTTGAGAAAAGTTAAAGAAGACCTTTATCATTTTCGAGGTCTTGTTCTGAAAGAGCAACGGGACTTTGGATTCGCCCTGAAAACAATGACCACTGAGGTCCATAATGCTCTCAGTAATGTCAGTTACTCTCATGAAGAGGAGCTAAAAGAAACACAA[C/T]AAACCCATCTCCAGAGTTTAAAAGAGGACCATGAAAAGCAGATACGAACACTGACAGAAGAGCTGGAGGGCAACCAGAAGATAGTCAAAGATGTCCAGAGAGCAATGCTGGAGTTGGAGGGGCTTGTGGAGCGCAAGGAAAAGGAAATATATCAGCTGGAAAGTGAGAGGGAAAGATCTACGCAAGAACTGCAAGATCTTCACAAGCAAGCTGTGCAAAACCTTGAAGAGAAGATCTTAAAGCAAAGCGAAGAACTCAAATCTGCATTGCTGTCCAAGGATGAACTCGCTGGGCAATTGGAGAAGCTTCACTTTGAGATTGAGCATGGCCAGCAGAAAATCAGACAGGAGATGAAGAATGCTGAGAAGGTGCATCTTCAGGAACTGGAGACACGGTTGAACCAGCAACACGAAGCAGAACTGCAGACTTTCAGACTAGAAAAAGAAAGTGCGCTTGACAAGCTTGTCCAGGACAACTTGGTTAAGCTAAGAGATCTGATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4263
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 1001 1625 13 22
Genomic Location (Zv9):
Chromosome 24 (position 36481117)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35100032
GRCz11 24 34986297
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAATGCTGAGAAGGTGCATCTTCAGGAACTGGAGACACGGTTGAACCAG[C/T]AACAYGAAGCAGAACTGCAGACTTTCAGACTAGAAAAAGAAAGTGCGCTT
Long Flanking Sequence:
ACTTTGGATTCGCCCTGAAAACAATGACCACTGAGGTCCATAATGCTCTCAGTAATGTCAGTTACTCTCATGAAGAGGAGCTAAAAGAAACACAACAAACCCATCTCCAGAGTTTAAAAGAGGACCATGAAAAGCAGATACGAACACTGACAGAAGAGCTGGAGGGCAACCAGAAGATAGTCAAAGATGTCCAGAGAGCAATGCTGGAGTTGGAGGGGCTTGTGGAGCGCAAGGAAAAGGAAATATATCAGCTGGAAAGTGAGAGGGAAAGATCTACGCAAGAACTGCAAGATCTTCACAAGCAAGCTGTGCAAAACCTTGAAGAGAAGATCTTAAAGCAAAGCGAAGAACTCAAATCTGCATTGCTGTCCAAGGATGAACTCGCTGGGCAATTGGAGAAGCTTCACTTTGAGATTGAGCATGGCCAGCAGAAAATCAGACAGGAGATGAAGAATGCTGAGAAGGTGCATCTTCAGGAACTGGAGACACGGTTGAACCAG[C/T]AACACGAAGCAGAACTGCAGACTTTCAGACTAGAAAAAGAAAGTGCGCTTGACAAGCTTGTCCAGGACAACTTGGTTAAGCTAAGAGATCTGATGGATTCCCATTCTGCCGAACTCAAGGAGCGTGATGGACGCTCAAAAGACATGGACGCTCGCATTACAGAACTTGCGGACGCTCGCTGCAAACTAGAAGTCGAAATGGCTCTTAAAGAGGCTGAAATGGAGGACATGAGACTCCAATACGAAGAAGCCAAAAGCACTCAGGAGGAGGTGTTGAAAGCAGAGTTTGCTACCCAAACAAGCACATTGAAGATGCAGATCGACACTTTAAGCTTGCAGCTTCATCAGAAGAATGAAGAGTATGAGGTTGGTCTGGCCGAACTTCGAGCTCTCATGAGGTTGGAAAAGGACCATTGCATCTCTGAACTCGTGGATCGGCACGAAGAAGAAAGCACGCTGCTTCGCCACGAGTTTTCAGCACTCAAGCAGAAGTCACAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24536
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Splice Site, Nonsense 1576 1625 21 22
Genomic Location (Zv9):
Chromosome 24 (position 36497657)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35116572
GRCz11 24 35002837
KASP Assay ID:
2261-8953.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATATTACTCACTCTTTCTTTTTTTCCCCCTTTTTCTTTTTTCTTTTTC[T/A]AGCGACAGGAGCAACAAGACGGCCGTGGGTTCTGGGAAAAGTCATGGAGA
Long Flanking Sequence:
TTCCATTGGAGTACAATTTGTTTCACTCACTCACTCAAAATATTAGTACAGATTTATTTAGTGAAAATATTGCATTATGTAGAACAATTCAGTCACATGCACACAACATTAGTACAGATTTAGTGAATATATTTAATCTGAGTACAATTCAGTTTCACACACGCACACATTAGTACAGATTTAGTTCCATTTTGGAGCAGTTATTTAAAATATGATGTATTTATATGAGCCTTATTTGTTTCAGTGACTTTTATAAGTACATATTTGCCTATTTAAATGATTCCTACATATTATTTGTATTTATTTATTAATACATTTTTCGAATTTACTGTTTTTCTGTAAATATTTCAGCTAAATTTGTGTTTGATATATATGCTATCAAAAACAGAAAGCATTATACTTTAAGTATTTTGTAGTTGTCTTTTACCTCACACCTTTTTTATTTTAGTCAAATATTACTCACTCTTTCTTTTTTTCCCCCTTTTTCTTTTTTCTTTTTC[T/A]AGCGACAGGAGCAACAAGACGGCCGTGGGTTCTGGGAAAAGTCATGGAGAAGGAATATTGCCAAGCCAAAAAGGTAGCGGTATTCTCTTATTCATGCAAATGTGTGTTTTGATTTCATTTGGCTAAATAATTTTCCCGCCTTTTTTCTAGAAAACCATTAACGCACTCTAACAGCGACATCTTTCAATGAAATAATACCAGATATTTTTCCTTGCATTTCTGCTCTATATTTGATTCACATTCAAAGACGCAAAAATAAAAGATGCAAACATTTGCGGATATTCGCAACACTGTATTTAGGCACACGAGAGAGTGCATGTGGAATTAATCCTGCATGTTAAATGACATAAATATAATGGTAATCAGCTATTAATCACTGCTGCAGGCACTTACATTCAATTATGTCATTTATTCTAATGATATATTTTAAACATGTCTATTTGTTATTATCTGTCTCCAGGCCCAAAACCGCTTCAAAGTTCCTCTCGGCACCAAATTCT
Associated Phenotype:
Not determined