Busch Lab

ZMP

setd8b

Ensembl ID:
ENSDARG00000076551
ZFIN IDs:
ZDB-GENE-071004-17, ZDB-GENE-071004-17
Description:
histone-lysine N-methyltransferase SETD8 [Source:RefSeq peptide;Acc:NP_001093559]
Human Orthologues:
AL356585.2, SETD8
Human Description:
SET domain containing (lysine methyltransferase) 8 [Source:HGNC Symbol;Acc:29489]
Mouse Orthologue:
Setd8
Mouse Description:
SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI Symbol;Acc:MGI:1915206]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa20592 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20592
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098758 Essential Splice Site 182 315 6 8
ENSDART00000123165 Essential Splice Site 182 315 6 8
Genomic Location (Zv9):
Chromosome 5 (position 72819452)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69017048
GRCz11 5 69789600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGGCACATTGAGGATCTCATCAAAAACGATGTGGAAGAGGGACTGAAG[G/A]TGAGCTTTTTAACATTAGCTTATGTTTATCTTCTACCTGACATCCTTTGG
Associated Phenotype:
Not determined