Busch Lab

ZMP

B0R0G8_DANRE

Ensembl ID:
ENSDARG00000076534
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0G8]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa39894 Nonsense Mutation detected in F1 DNA Not yet available
sa5159 Essential Splice Site F2 line generated Not yet available
sa32982 Nonsense Available for shipment Available now
sa8755 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19829 Nonsense Available for shipment Available now
sa18734 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39894
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113485 Nonsense 43 1086 3 40
ENSDART00000143743 None None 299 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37953475)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38268389
GRCz11 2 38250717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCACCTCTGTTTCACCACTTTCACCTCTGTGTTCCACCTATTCAGTCT[T/A]AAAGATTCTCCAGAAATTCGTCGAACTGCAGGAGATTGAAACGATAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5159
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113485 Essential Splice Site 140 1086 7 40
ENSDART00000143743 None None 299 None 11
Genomic Location (Zv9):
Chromosome 2 (position 37951596)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38266510
GRCz11 2 38248838
KASP Assay ID:
554-3580.1 (used for ordering genotyping assays)
KASP Sequence:
ACATTGATTATTTTCCACAATAGATGAMGATAAAGTTTGTTTTGTTTTTA[G/A]TGCTGCAGATTGTCAAACTGCAAATTGAAGCGATGGACCTACAGACACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32982
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113485 Nonsense 614 1086 24 40
ENSDART00000143743 None None 299 None 11
Genomic Location (Zv9):
Chromosome 2 (position 37944244)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38259158
GRCz11 2 38241486
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTGAAAGGAAACTAATTAAGAAGGAGGAAGAAAATGAAGAAATTCTC[A/T]AGGAGAATGAAAGTAAGCTAACACATTTCACAAACACCTTCGGGAATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8755
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113485 Essential Splice Site 709 1086 28 40
ENSDART00000143743 Essential Splice Site 39 299 2 11
Genomic Location (Zv9):
Chromosome 2 (position 37941633)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38256547
GRCz11 2 38238875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGGAGGCAAAGCGGAARTTAAGAGCTCAAGGATCCATATCTGCCAAAA[G/A]TGAGTTTAGTTTAACTGCAWCCTCTGCTTTCTTCATCTGAAGAGAGRCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19829
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113485 Nonsense 778 1086 31 40
ENSDART00000143743 Nonsense 108 299 5 11
Genomic Location (Zv9):
Chromosome 2 (position 37941067)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38255981
GRCz11 2 38238309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATAATGTCTCTAAAGGAATCAATGTCTAGACTAAAGCAAGGACAAACA[C/T]AAATGCAAGAGAAATACACACGGGAAATCAATGGTACGTTCAACTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18734
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113485 Nonsense 845 1086 34 40
ENSDART00000143743 Nonsense 175 299 8 11
Genomic Location (Zv9):
Chromosome 2 (position 37940563)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38255477
GRCz11 2 38237805
KASP Assay ID:
2259-2403.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAATGAAATTAGTTTTTTACATATAAAATATATATTTTTGCAGCACTG[G/T]AGAAACAAATTAGCAGAAAGAATCAGCAGCTTGCCACAACTGAAGACAAA
Associated Phenotype:
Not determined