Busch Lab

ZMP

slco1f3

Ensembl ID:
ENSDARG00000076531
ZFIN ID:
ZDB-GENE-080212-5
Description:
solute carrier organic anion transporter family, member 1F3 [Source:RefSeq peptide;Acc:NP_001129156
Human Orthologue:
SLCO1C1
Human Description:
solute carrier organic anion transporter family, member 1C1 [Source:HGNC Symbol;Acc:13819]
Mouse Orthologue:
Slco1c1
Mouse Description:
solute carrier organic anion transporter family, member 1c1 Gene [Source:MGI Symbol;Acc:MGI:1889679]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24811 Nonsense Available for shipment Available now
sa44438 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24811
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113623 Nonsense 191 559 6 13
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 103702)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75941666
GRCz11 4 77326196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAGCTCTACCTGAAAATTCCCAAATTTCTGAGCTAAACCACCCCCGG[C/T]AACAGCACAAAACCACCCCCAGCCTTACAGAGATAGTCAAAGGTACGGCA
Long Flanking Sequence:
TGCTGAAAATATAATTGACTAAATTGACTGGCATTGGACGAGTTAAAGAAATCAAAACAAAAACAGACATGACTGTTATGAATCGCACATTTTCAAAGCAGAACAATTAACTTTAGCATTGTTTTTCTCTTAAATATCTAAATGTGACCACGTGAGATCAATCGAAGACCAAAACATGACCTCTGTACAGAAATTTTAAACATGGACCAATCATTCTTTTTCAATGTCCAATCACTTTGTTTAACCTCATGTTGTTAAGAACAAGGGAAATTGTTCTTCATTTGTCTTGAAATATTACTAATAATTATATTATTTATTTACATATTCTCCTGTTATTAGCAAGCGTGACCATCACACCGCAGGACTATCGCTGGGTTGGGGCTTGGTGGTTGGGTTATGTGGTGTCTGGCCTGTTCACTCTACTTGCTGCTTTTCCTTTGTGGTTCTTTCCAAGAGCTCTACCTGAAAATTCCCAAATTTCTGAGCTAAACCACCCCCGG[C/T]AACAGCACAAAACCACCCCCAGCCTTACAGAGATAGTCAAAGGTACGGCAATTTTATATAGTCGCCTCCTCTGACAATGTAAAAAAGCACTTTCATATTGTTAAAAAATGTCCTTATTTACTTCTTTCCTAGATTTTCCACCATCCTTTAAGCATCTACTTACCAACAAGATTTACATTCTGTACCTAGCTCACAGTATTGTGGCATTTAACGACTTTGCCATAGGGGCGTCATACACACCGAAGTATCTGGAACAGCAGTTTGGACAGAGCGCATCCAAAACCAACTTTCTCATAGGTGACAACTGTGATGGTTACTTTATCGTCAGTCTGTTTAAACTAATTGCTTTTATTTATGCTGTATTCAGGAGCGACATCTGTTCCAGCAGTGGCTCTGGGTATTTTTCTGAGTGGGTTGATGATGAAGAGGTTTAAATGGGATCTGCTGACATCTGCAAGAGTGAACTTGTACGCTGGTGTTGCCATGTTGTTTTTGGCCGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30491
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113623 Essential Splice Site 325 559 8 13
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 104266)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75941102
GRCz11 4 77325632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGCTGCGGAAATCTAGAAGTTGCAGGGGTTACAGTGCCCTATCAAGG[G/A]TAATTTTATTTCCATGCTCCTATTCGATCTATTAATTTTCAAGTCACTTG
Long Flanking Sequence:
GCCTCCTCTGACAATGTAAAAAAGCACTTTCATATTGTTAAAAAATGTCCTTATTTACTTCTTTCCTAGATTTTCCACCATCCTTTAAGCATCTACTTACCAACAAGATTTACATTCTGTACCTAGCTCACAGTATTGTGGCATTTAACGACTTTGCCATAGGGGCGTCATACACACCGAAGTATCTGGAACAGCAGTTTGGACAGAGCGCATCCAAAACCAACTTTCTCATAGGTGACAACTGTGATGGTTACTTTATCGTCAGTCTGTTTAAACTAATTGCTTTTATTTATGCTGTATTCAGGAGCGACATCTGTTCCAGCAGTGGCTCTGGGTATTTTTCTGAGTGGGTTGATGATGAAGAGGTTTAAATGGGATCTGCTGACATCTGCAAGAGTGAACTTGTACGCTGGTGTTGCCATGTTGTTTTTGGCCGTACCTTTCTTCGCTCTCAGCTGCGGAAATCTAGAAGTTGCAGGGGTTACAGTGCCCTATCAAGG[G/A]TAATTTTATTTCCATGCTCCTATTCGATCTATTAATTTTCAAGTCACTTGTGTGCTGTCGAATGACATAACAATTAATCGTTTATGTGGCAGATCTACTGAAGTTCAAGGTGTAATAAGTGATGTACTCCCTTCTTGCAATGCTGACTGTGGGTGTCCAGACATCCATTGGGATCCAGTGTGTGGAGAGAATGGAGTGACCTACATCTCCCCTTGCCATGCGGGCTGTAATTCCACTCTGGGTGCAGGACGGAATATGGTGGATGCAGCGCATAACAATCTTTCGATCTCTCCTTCAATTCTTATTACATGTTTGTTAGTCTACTTTCCTCTTTCTTGTCTTGTTTTGTCAGACATTCCATGACTGCGGCTGTATTCAGAGCTGGGGACTGAGCGTTGGCAACTCCTCTGCAGTTCTTGGCCAGTGTTCAAGAGATCCCAAATGCAACAGAATGTTCTACATTTATCTGGGATTGCAGTCTTTGGCCTTCTTTGTGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44438
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113623 Nonsense 405 559 10 13
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 104693)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75940675
GRCz11 4 77325205
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGCTGGGGACTGAGCGTTGGCAACTCCTCTGCAGTTCTTGGCCAGTG[T/A]TCAAGAGATCCCAAATGCAACAGAATGTTCTACATTTATCTGGGATTGCA
Long Flanking Sequence:
TTTTGGCCGTACCTTTCTTCGCTCTCAGCTGCGGAAATCTAGAAGTTGCAGGGGTTACAGTGCCCTATCAAGGGTAATTTTATTTCCATGCTCCTATTCGATCTATTAATTTTCAAGTCACTTGTGTGCTGTCGAATGACATAACAATTAATCGTTTATGTGGCAGATCTACTGAAGTTCAAGGTGTAATAAGTGATGTACTCCCTTCTTGCAATGCTGACTGTGGGTGTCCAGACATCCATTGGGATCCAGTGTGTGGAGAGAATGGAGTGACCTACATCTCCCCTTGCCATGCGGGCTGTAATTCCACTCTGGGTGCAGGACGGAATATGGTGGATGCAGCGCATAACAATCTTTCGATCTCTCCTTCAATTCTTATTACATGTTTGTTAGTCTACTTTCCTCTTTCTTGTCTTGTTTTGTCAGACATTCCATGACTGCGGCTGTATTCAGAGCTGGGGACTGAGCGTTGGCAACTCCTCTGCAGTTCTTGGCCAGTG[T/A]TCAAGAGATCCCAAATGCAACAGAATGTTCTACATTTATCTGGGATTGCAGTCTTTGGCCTTCTTTGTGTACAGTCTTGGCACTGTTCCCTATTTCACCTTGTCTTTGAGGTTTCGTTTTCACTTCTTTCTTTAAAAAAAAAAAAAGTTTTCATAATGTTTTGCATCCCAAGCATAAACAGAAAGCTTTACTTATATGTCCACACTGCCACCAACTGGCACATCACTCCTGTAGAAAGCATAATTTGCTCAAGCCTTGTTGCTAATGACAGTTGAACATTTACATCAGGAGTGAACAACCCTGTTCCTGGAGATCTACCTTCCAGCAGATTTCAACTCCAACCCTTATCAAACACACCTGCCTGTAATTATCAAGTGCTTTTCAGGTTCTAATTAATTGGTTCAGGTGTGCTTGATCAGGGTGGGAGCTGAACTCTGCAGGAAGGTAGATCTCCATTAACAAGGTTGAGCCCCCCTGATTTACATTTACATTTAGTCATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19388
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113623 Nonsense 471 559 12 13
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 107517)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75937851
GRCz11 4 77323113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTATAATGCAATGTTACTTTTTATAGGTGGTATTCCTGCTCCCATTTA[C/A]TTTGGAAGTCTTATTGACTCTACCTGTCTGAAATGGGGCAGGACTAAATC
Long Flanking Sequence:
CTTGTTGGAACAACTAACCCCCATGCGAAGAGTCGCCAGTTCAATCCCAGCCCGAAGTGAGTTGGGTAGTCTAGAATTTCTGTTTTATAGCAAAGAAATCTTAAATGATTGGAGTTGTGATTGGACACTATATAAAAAAATTTAATTAAATAATAACTTTCAAGAAAACACAAAATTAAAAGCCATTTCCGTAGTAAAGCATTTGTGTTTAAAGACTAAAAAAAAAGGGAAAGCTAATATAGAGCTACATGTGGCTTTGTGCAAATGTGTATGCGAATTGGAGTTTATACCAAAAATCTTATTGAGAACATGTTCTTGCAGGATTGTGGACCCTGAGCTGAAGTCAATCTCTGTGGGAATGTTACTGTTCACTGTAAGAGTTTTGGGTGAGTGTGTTGTGGAATGTTTATTTTCTTGTCTTAGACCGCCATTTAGGCCTGGTGCAGCATTGTTTATAATGCAATGTTACTTTTTATAGGTGGTATTCCTGCTCCCATTTA[C/A]TTTGGAAGTCTTATTGACTCTACCTGTCTGAAATGGGGCAGGACTAAATCTTGTGGAAGAGGTGCCTGCAGAATTTATGACATTGAGACATTCAGGTGAGCTGAACTGTTATATTAACTCTGCTATATCCTACATAATTTTAATCTCTACGTAATTTTTTGTCCACTATAAGGTTTCTCTTTCAGGGACTGACCATCGGTCTTCGAGTATTAGCTTATTCCCTCCTCTGGATAGCCACTATAGAGATACAGAGAAAAATGAAGAATGATAAACAATTGTCCAGAGACACAGAACTCCAAAAGTCTCCATCCAACGATCCAGAACACGAGGAGACTATAAAATAATGATCTGTGGTGTTTTAAGTGCACCTTATGCATTTAATTGTACGTTTTTGCATTATTATCAGTGGTAAATGTACATGCAGAAACAAGTTGAGAGAAAAAGGTTCATTTGTGCGTGTCGATTTTGTGTGTGTGTTAAAATATTTATTGGGAAAATGC
Associated Phenotype:
Not determined