Busch Lab

ZMP

si:dkey-46k9.10

Ensembl ID:
ENSDARG00000076480
ZFIN ID:
ZDB-GENE-081104-416
Human Orthologue:
MCF2L
Human Description:
MCF.2 cell line derived transforming sequence-like [Source:HGNC Symbol;Acc:14576]
Mouse Orthologue:
Mcf2l
Mouse Description:
mcf.2 transforming sequence-like Gene [Source:MGI Symbol;Acc:MGI:103263]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41441 Nonsense Mutation detected in F1 DNA Not yet available
sa7189 Nonsense Mutation detected in F1 DNA Not yet available
sa15537 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41441
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115290 Nonsense 265 1059 8 29
ENSDART00000140388 Nonsense 238 514 7 12
ENSDART00000140477 None None 346 None 10
Genomic Location (Zv9):
Chromosome 9 (position 30632033)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29787979
GRCz11 9 29598725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTCAGGAAGACATGGCAGGAGCTCTCAGCCAAGGTCGGAAAATCT[T/A]GGAGAATATCAGAGAGCCGGTGCGCAGAGATCCGGACAGCAGTTTGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7189
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115290 Nonsense 402 1059 11 29
ENSDART00000140388 Nonsense 375 514 10 12
ENSDART00000140477 None None 346 None 10
Genomic Location (Zv9):
Chromosome 9 (position 30633419)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29789365
GRCz11 9 29600111
KASP Assay ID:
554-5066.1 (used for ordering genotyping assays)
KASP Sequence:
GGTTTGATTGACAGCTCTCAGATTCTTGATGACAGTATTGCAGCAAAATG[C/A]AGTGAGCTAGAAAAAGCAAGTGAAAATCTCACCCAAGAGCTTAAAGACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2487
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115290 Nonsense 687 1059 19 29
ENSDART00000140388 None None 514 None 12
ENSDART00000140477 Nonsense 113 346 5 10
Genomic Location (Zv9):
Chromosome 9 (position 30638517)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29794463
GRCz11 9 29605209
KASP Assay ID:
554-2657.1 (used for ordering genotyping assays)
KASP Sequence:
CTCAGACCTTTGGCCATTGTGCTTGTTTAGATGGGGGAGCTGCAAATTTA[T/G]GAGAAATACTGTCACAACAAACCTCGTTCTGAGAGTCTCTGGAGACAGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8342
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115290 Nonsense 738 1059 20 29
ENSDART00000140388 None None 514 None 12
ENSDART00000140477 Nonsense 164 346 6 10
Genomic Location (Zv9):
Chromosome 9 (position 30639884)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29795830
GRCz11 9 29606576
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGACTGGACTCTTACTTACTGAAGCCTGTWCAGAGGATCACTAAATAC[C/T]AACTTCTGATTAAGGTACTGCATNNNNNNTRTATGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15537
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115290 Nonsense 910 1059 24 29
ENSDART00000140388 None None 514 None 12
ENSDART00000140477 Nonsense 336 346 10 10
Genomic Location (Zv9):
Chromosome 9 (position 30641783)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29797729
GRCz11 9 29608475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAGRTTAAGACCATCTGGGTGACAGAAATCCGSAAACTTCTAACAGGA[C/T]AACTGGAAGCCTGCAAAGGTATGTGGTTGGATTAARGTTGATTTAGCAGT
Associated Phenotype:
Not determined