Busch Lab

ZMP

LOC567335

Ensembl ID:
ENSDARG00000076466
Human Orthologue:
MAML1
Human Description:
mastermind-like 1 (Drosophila) [Source:HGNC Symbol;Acc:13632]
Mouse Orthologue:
Maml1
Mouse Description:
mastermind like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1890504]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa11346 Nonsense Available for shipment Available now
sa16401 Essential Splice Site Available for shipment Available now
sa22440 Nonsense Available for shipment Available now
sa10050 Nonsense Available for shipment Available now
sa16266 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11346
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Nonsense 413 1048 2 5
Genomic Location (Zv9):
Chromosome 14 (position 14085182)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16097123
GRCz11 14 16402776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCARCAGCATGWAGTTCAAAAGCCACCACAACAGAAAYCTCCACAACAG[C/T]AACCAACAAAGTTCCACCAACAGCCCAGCCACTCTACATCTTGGCCCCAA
Long Flanking Sequence:
ACCTTAACCTGAATGATCAGGACTGGAGTGAGATCATGGAGGAGTTCAATCGCTCTGTACCCTACGAGGACATCCAGGAGCTCTTCAGCGTTAGTTTTGGAGATCGCAAAGACCCAGATCTCACATCTGCTGCAGCTCAGAGCTTGATATCACAAGATCTGCCTAACGTGAAGACTGAAATTTCTCCTGCCACGGCTACCTCTGCCTTTGAGCAGGACTCCTGCAATGGTTCACCTCAGATGAGACCGACTTCATCGGGACCTCCGCTTCACACCAACTCTCCTGTTACGGCTCCGGCCACTTCACCAGCCCTGCCTGTTCCACAGCATTCGCAACAGGGGTCTATTCAGAGCAGAGCACTCCCAAATCACTTGATGCCCGTTCCACCCAAAGACCTGTCCCCTGCTCAGCAGCTGCAGCAGTTGGCTCAGCAGAGAGCGATTTTACACAGTCAGCAGCATGTAGTTCAAAAGCCACCACAACAGAAACCTCCACAACAG[C/T]AACCAACAAAGTTCCACCAACAGCCCAGCCACTCTACATCTTGGCCCCAAAATGCTCCCACCCAAAGTCAAATGGGTGGTACGTTTGGGCTTGAGAAGCCCACCAGTCCTTCTTTGTACCCTCAAGACTTTCCCAATCCCAAGACCCTACTCATGCCAAACAAAGGTTCTCCCAAAGCGGGTGCTCCAGCTGGCTACATGCAGCCTGGTGGCCATGCCAACATGTTAAGTCACCCAGCAGCACCCACAGGGCCCCTCGGCCATCCTTCCAACCCAGGTGCCCAGGCGGCCATGTTGGACTTCAACAACACTAAACCACTGTCTCATTATGACGACGGACCACCAGGGGCACCCAGGGGCCCTCCGACCACACAGAACCACAACAAACCGAACCAGGCCATCCTAAACATGATGCGACAGCAACAGATCCAGAAACAAAGGGCGCCTACCATGAACTTCAGACCAGCACATCTACCACATACTGCGGTAAGACTGGATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16401
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Essential Splice Site 574 1048 2 5
Genomic Location (Zv9):
Chromosome 14 (position 14084695)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16096636
GRCz11 14 16402289
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGGCGCCTACMATGAACTTCAGACCAGCACATCTACCACATACTGCGG[T/C]AAGACTGGMTTCCCACTGCACACCTCACATTTATTTTTAWTTAGGAAGTT
Long Flanking Sequence:
ACCTCCACAACAGCAACCAACAAAGTTCCACCAACAGCCCAGCCACTCTACATCTTGGCCCCAAAATGCTCCCACCCAAAGTCAAATGGGTGGTACGTTTGGGCTTGAGAAGCCCACCAGTCCTTCTTTGTACCCTCAAGACTTTCCCAATCCCAAGACCCTACTCATGCCAAACAAAGGTTCTCCCAAAGCGGGTGCTCCAGCTGGCTACATGCAGCCTGGTGGCCATGCCAACATGTTAAGTCACCCAGCAGCACCCACAGGGCCCCTCGGCCATCCTTCCAACCCAGGTGCCCAGGCGGCCATGTTGGACTTCAACAACACTAAACCACTGTCTCATTATGACGACGGACCACCAGGGGCACCCAGGGGCCCTCCGACCACACAGAACCACAACAAACCGAACCAGGCCATCCTAAACATGATGCGACAGCAACAGATCCAGAAACAAAGGGCGCCTACCATGAACTTCAGACCAGCACATCTACCACATACTGCGG[T/C]AAGACTGGATTCCCACTGCACACCTCACATTTATTTTTAATTAGGAAGTTTAAATACCTAGAAATGGAAATTCTCTTATCATTTACCTGCCCTCATTTTGTTGCAAACCCTGTAAGAATCAGGATATTTATGTCTGATCTTGGGCTGGGCGATAATAGGATATCAAGAATTATCATGATAAATGTTTTTCTGATAAAGCGATAATGACAGTTTGATTAGTGTTCGATGCTGCACAGTATATTTGCAGCCTCCCCTTCCTGATGCCGCACACAGTACAAGTGTACAGCCGTACAGTGGAAGTTGCACTTGGAGGGGTAAGAAAAACAAACAACAGCCCCAAACAGTGTGTTGGTACACCATCAGTGTTGGTAAACCATCACAACTACCCAGCAATGTAAAGACAGAAAAGACAGACGAAAGATATGACAGACACTTGATGAACACTTGATGCTTTCTGCAAACTACAGGCTGCATCATTTAAGGGCATTGTTACGACATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22440
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Nonsense 630 1048 3 5
Genomic Location (Zv9):
Chromosome 14 (position 14072219)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16083950
GRCz11 14 16389603
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAAATTCAGCTGATGAATCAACAGAAACAGTTTCAGCTCCAGAGA[C/T]AGATCATGGTTGAGCAGGTGCTTTTTTTCTTACCCTTTATCATTTTGGTA
Long Flanking Sequence:
ATATATTGTTGAACATAAAACATAATTTGGTAAATTGTGTGTGTGTGTCTGTGTGTGTGTTTATATATATATATATATATATATAAGTCAGCGATGACCAGAAGTGTATGGTTTTACTGTTGTTCTTCAAAAAAATTATAGCAATAACTATTTTTTTTTTTTTTTTTTTTTACTCTAAATTAGAAATATAAACTGCCAGTAGGGAGAGTAATTTCTTTATTTAAGTTACAGTCTAATAGAGAAATAGTGCAAATGACTTTAGCAATGAGTCATTAAACTGTTGGTACACCTGATTCTTTTTTTAATAAGAGACACCTCTTACTTTCTCTCAGCAGGATTCAGGCTCCTACCCTCCTAACACGCACGTTCCCGGTCCCAGCAACACCATGACCCCACAAACAAGCAGCAACAGCATCCCGGGTCACCATAATAATCCTGCCTACTTGAAACAGCAGCAAATTCAGCTGATGAATCAACAGAAACAGTTTCAGCTCCAGAGA[C/T]AGATCATGGTTGAGCAGGTGCTTTTTTTCTTACCCTTTATCATTTTGGTACGTTGCCAGCAGTAGTACAAAGACACAAATGTTCAGTAAATGCATTAATTAGTACTAACAATTATAATCCTATTATACTGAAATACTGCGATATAATAGAGTTTAACAGACCACTTCGAAATAACTGTTTCCTTATTTAACCTAATTTATTTCTGTCGTGATAAAAAGCCTAAATTTCAGCAGTCATTCCTTTAGTCTTCAGTGTCACATGATCTTTTGAAAATCAATGATTTGCTGTTAAATATATCTAAAACTAATATACGAGTTATAATGTAATAGTATATCAAATAAAACAAACATAATATTTTGCAAAGGTGAATCAAAAGTAACTGTGAAGGCATTTAAAATGACTTCTCAACCTTTTGCACTTTGGAGCCCTCTTCTTTCTCCGATAATTTTTTTTTTAAGGCCCACCTGTCTGACATTTTCTCATAAATTTATAAAATGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10050
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Nonsense 661 1048 4 5
Genomic Location (Zv9):
Chromosome 14 (position 14069385)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16081255
GRCz11 14 16386908
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAGCTGCAGAGACAWTTGACCCGTCCACCACCTCAGTACCAGGACCAA[C/T]AGAACCCGCAGGCCCAGCAGAACCCTTTYCAGCAGCAACAGCAGYAGGTC
Long Flanking Sequence:
GAGTCTGTAAACCGTCCTACTTCATAGACCTGCCTCCAGGAGGCAGCGTTCTCACAAAAATTCACAATGCAGTGATGGTTCACCCAAAAATAAAACATTACCTCATCATTTACTGTCCCTCATAAGATTTTAAACGTTTATGATTTTCTTTCTTTTGACCAAAAAAAAGATAATTTCAAGAATGCTGGTTGCTGAAGCCTATTTTCTTCCATATGGATGGAAAAAATACCATAGAAGTTAATGGGTTCCAGCAACTAGTGCTTTCCAAAATATCATCTTTTGTGTTCAACTGAAGAAAGAAAATCAGAAAGATGTTGAGAAAATGAAGAGTGCATAGATGGCAGATTTTTCCATTTTCATTGAAGTCTGTGGGATACTGTAAGTTAACCATTGTTTTTTAGTAATAACTGAAGCGTTTGTTATAGGAGAAGCAGCGGCAGCAGCAGGAACAGCAGCTGCAGAGACATTTGACCCGTCCACCACCTCAGTACCAGGACCAA[C/T]AGAACCCGCAGGCCCAGCAGAACCCTTTCCAGCAGCAACAGCAGCAGGTCTCCCAGTTCACCAGTGTGCCGCCCTGCCTGGCCCAGCAGCACACCTCCAATTTCAGCGAACACACCATCTCTGGTAATCACTTTTCTACTTGATTATCAAATGACCACATTTACACCTGCTGTAACTTGTCTTTTATGTTGGATCAGTTGTATTCTGTCAACAAGAATTAATCAAGACATACACTTCTACTGGAATGTGGTTATGTCTGACCATTGCTCATATTATATAGTTATATAGGGGTTTGGATCCAGCCAGGAATTAACATCAGACCTTTGTATCTTTCACGTCTCTTCTTTTTTGATCATGTAAAGTTCCATATAATTTGAGCTTCCTCCCTCGGTAGGTCAACACAAGTAGCCTTTTGTTACTAGTCAACAAACAAGCCCATCTGGTTTGCATTTGTGTGTGCTTATTGATAGACTAATTTGAATGTCAGAAGTACAAAATAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4552
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Nonsense 676 1048 4 5
Genomic Location (Zv9):
Chromosome 14 (position 14069340)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16081210
GRCz11 14 16386863
KASP Assay ID:
554-3549.1 (used for ordering genotyping assays)
KASP Sequence:
ACCAACAGAACCCGCAGGCCCAGCAGAACCCTTTYCAGCAGCAACAGCAG[C/T]AGGTCTCCCAGTTCACCAGTGTGCCGCCCTGCCTGGCCCAGCAGCACACC
Long Flanking Sequence:
GCGTTCTCACAAAAATTCACAATGCAGTGATGGTTCACCCAAAAATAAAACATTACCTCATCATTTACTGTCCCTCATAAGATTTTAAACGTTTATGATTTTCTTTCTTTTGACCAAAAAAAAGATAATTTCAAGAATGCTGGTTGCTGAAGCCTATTTTCTTCCATATGGATGGAAAAAATACCATAGAAGTTAATGGGTTCCAGCAACTAGTGCTTTCCAAAATATCATCTTTTGTGTTCAACTGAAGAAAGAAAATCAGAAAGATGTTGAGAAAATGAAGAGTGCATAGATGGCAGATTTTTCCATTTTCATTGAAGTCTGTGGGATACTGTAAGTTAACCATTGTTTTTTAGTAATAACTGAAGCGTTTGTTATAGGAGAAGCAGCGGCAGCAGCAGGAACAGCAGCTGCAGAGACATTTGACCCGTCCACCACCTCAGTACCAGGACCAACAGAACCCGCAGGCCCAGCAGAACCCTTTCCAGCAGCAACAGCAG[C/T]AGGTCTCCCAGTTCACCAGTGTGCCGCCCTGCCTGGCCCAGCAGCACACCTCCAATTTCAGCGAACACACCATCTCTGGTAATCACTTTTCTACTTGATTATCAAATGACCACATTTACACCTGCTGTAACTTGTCTTTTATGTTGGATCAGTTGTATTCTGTCAACAAGAATTAATCAAGACATACACTTCTACTGGAATGTGGTTATGTCTGACCATTGCTCATATTATATAGTTATATAGGGGTTTGGATCCAGCCAGGAATTAACATCAGACCTTTGTATCTTTCACGTCTCTTCTTTTTTGATCATGTAAAGTTCCATATAATTTGAGCTTCCTCCCTCGGTAGGTCAACACAAGTAGCCTTTTGTTACTAGTCAACAAACAAGCCCATCTGGTTTGCATTTGTGTGTGCTTATTGATAGACTAATTTGAATGTCAGAAGTACAAAATAGTAAGTGTGTGGCGAGGTGTTCTACTGTTACACGCAGCGTACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16266
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Nonsense 1023 1048 5 5
Genomic Location (Zv9):
Chromosome 14 (position 14067367)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16079237
GRCz11 14 16384890
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAACACCCAATCGGGAGGCAGYTTGTCTGGGTTTCCAGCCGAGACTGATT[T/A]AGTGGATTCTCTGTTGAAGGATCAGTCGACACAACAGTGGATGGACGATA
Long Flanking Sequence:
GGCTCAGTCTTGGCAGCAGCAGCCACCCCAGCAGCATCCAGCTCTCCAATCTGGCTCTGCGAATGGAGCCATGCCAGCTGGTTTCCCCAATTCCAGCTTTCACATGCAGTCAAGGTTGACTAAACTTCCCAACAACACCCCATTTCCCCAAGGGGGCATGGGGAACAGTGCGGCAGGTAGAACCATGGGAGGTATGAATCCTGGACAAATGATGACTAACATGAACCAGCAACGGACAAATAACCCAGGCATGCCCCAGCAGCTGCCACCTCCAGTCCAGCAGACAGCCCAGCAGGGTCAGCCACAAGCACCACCGCAAACCCAGCAGGTTTTGCCTGACTTGGGGCCCTTTAGCCAAGCACAGGCCGTACCCAACCGCACCACAGGACTTCAGTGCAATCAGGCCTACCAGCTCAACAGGGCGGCCAATCAGCAGCTCCAGTTCAGCTACAACACCCAATCGGGAGGCAGCTTGTCTGGGTTTCCAGCCGAGACTGATT[T/A]AGTGGATTCTCTGTTGAAGGATCAGTCGACACAACAGTGGATGGACGATATAGATGAGCTTTTGGCCAGTCACCAATGAGTGACACCAAAGCTAGTGCCTTCGATAGACAAGATAGCGTGAAGATCCAGATTTTGGATGATTTGTGAGATGGTGAACCTGCTTGCATCACATGGTCAGATCTGCTGTGTTCTCTTTTGAATATATCTATATATATATATAATGGTGTATATAATGGAAGTCAAGTAGAGCACAGAGCCTGCCTCACAGAAGTGTTCTCTGGACTTAAAATTTCAAAGAGGGAAATGCTCTACTACTGAACCTGTGGCTCAGTAAAACCACTGAATTTTCCTATATAATGAGTTTGTGCTCATGAATGCGTTCAGCTGTTCGTCCAGTTGGGTTGCCTTTGTGTTCACTGTAGGCATGAAGAGGCTATGTTCAGTATCAGGAAGGTCTTGACACTTCCGCATGCCTTATAATTGCACTCCTGAAGAGGCAC
Associated Phenotype:
Not determined