Busch Lab

ZMP

serpinf2

Ensembl ID:
ENSDARG00000076448
ZFIN ID:
ZDB-GENE-060822-1
Human Orthologue:
SERPINF2
Human Description:
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member
Mouse Orthologue:
Serpinf2
Mouse Description:
serine (or cysteine) peptidase inhibitor, clade F, member 2 Gene [Source:MGI Symbol;Acc:MGI:107173]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15059 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29652
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109904 None None 457 None 7
ENSDART00000145150 Essential Splice Site None 457 2 8
Genomic Location (Zv9):
Chromosome 21 (position 38930537)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40070602
GRCz11 21 40094155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTCTATGTGTAAAAATTTATATTGATTATTTTGTTTTTGTGTGTTTC[A/C]GGCCAGCAGTAAGAACATGAAGCACTACCTTTTAGTGCTTATATTGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15059
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109904 Essential Splice Site 132 457 3 7
ENSDART00000145150 Essential Splice Site 132 457 4 8
Genomic Location (Zv9):
Chromosome 21 (position 38934481)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40074546
GRCz11 21 40098099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAACAGCCAAAGCTGTCAAGATGGCATCTCGTCTGTACCTCGTACCAGG[T/C]GAGGTTTTGTTTTTTTCAGRCTATACCTGGWTAATCRTGTTTAGATTTGG
Associated Phenotype:
Not determined