Busch Lab

ZMP

zgc:163143

Ensembl ID:
ENSDARG00000076437
ZFIN ID:
ZDB-GENE-070410-143
Description:
hypothetical protein LOC795946 [Source:RefSeq peptide;Acc:NP_001077038]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa1113 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26105
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113036 Essential Splice Site 206 413 6 12
Genomic Location (Zv9):
Chromosome 3 (position 34694416)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34479612
GRCz11 3 34609120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTCCTTTAGAACATCCACTGGGCTGGTGACGATGAATTAAATATT[G/T]TAAGTAGTCATGTTTTTAAATAAATTCCAGTACAATTCCTAATATATAGA
Long Flanking Sequence:
AAATAATATTTGACTAGATGTTTTTTAAGACACTTCTATACAGCTTAAAGTGACATTTAAAGGCTCAACTTGGTTAATTAGGTTAACTAGGCAGGTTAGGGTAATTTTGCAAGTTATTGTATAATGATGGGTTGTTCTGTTGACTATCGAAAAAATATAGCTTAAAGGGGCTAATAATCTTGACCTTAAAATTGTTTAAAAAATTTTTAAAACTGCTTTTATTCTTGCCAGAATAAAAGAAATAAGACTTTCTCCAGAAGAAAAAATATTATCAGACATACTGTGAAAATGTACTTGCTCTGTTAAACATAATTTGGTAAATATTTAAAGAAACAAAATCAAAGGGGGGGCTAATAATTTTCATTTCATTTTCATCTTAATTTTAAAGACTTCAACTGTATATTACATTTTAAGCTTCAAAATATGGATCACACAAATAATAATTTTTTTTTTTTTTCCTTTAGAACATCCACTGGGCTGGTGACGATGAATTAAATATT[G/T]TAAGTAGTCATGTTTTTAAATAAATTCCAGTACAATTCCTAATATATAGAAAACTCAACCAAAAAGTGTTGTGAAAGTTCTGTTCATCAGTATGTAATTATTTCTTAATCAGGTGCCCCATGTGGTTTATGGAGTTCTAGGACAAACCAAACCCCAAATAATTGAGGTAAGACTGATTGTCTCTGAGCTGCAAAGCTTGTCAGAAATAATTATCTGGTATTGGCTAAGTTTTGTTTAGACAGGGTACTTTGCTTTAAGTTAGTTTCTGGGGAATTATATTTATTTTAAAGATAACAACCGGTGAGGTCCTCTATTGCACCATACTGTGTTTTACATGGAGAATATGATCACAGCTGTTCTGGATATATTCCAGCTCTTACTTGCTTAGGATTTTCCCACGTGGTGCTGTGCTCACAATTGGACTGTTTTATTGATTCATCACATTGGAATTATAAGGCTGTATCTGACATTTTGTCAAAATTGAGTTATTCGCATATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1113
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113036 Essential Splice Site 303 413 9 12
Genomic Location (Zv9):
Chromosome 3 (position 34691211)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34476407
GRCz11 3 34605915
KASP Assay ID:
554-1015.1 (used for ordering genotyping assays)
KASP Sequence:
AGTATTGTCATGCATTAATTGGTTGACATTTTCATGTCTTTATCTCTGTT[A/C]GATTAACCGTGAACTGAAGAAACACCTGAGGTTRAATGCAAACGCTTTAG
Long Flanking Sequence:
TTTTATTATTCGGCTTTGATGAGAATAGAAGACATCAAGTAAAGGCTCCTTAAACCCAGTTTTACCAGTTGTTACAGTAAAAAAGGGAAGAAAAGGAGATTGGTAACACAACAGTATCTTTAATTTAACACAGTTATATTTCGCATTGATTTAAAAACTTCAAACCTTCCTACAAATTCATGCTGCAATTAAACATTATACACAACAAAAACTACATTATACGAGCACACATATTGTCTTCTCTGTAATTTATGCACAAATAAAGGAACAGTTGTTTGTATTTGCCCTTTGCAGTAAGTATATATAAATGCCCTCATTGTGCTGTTGTAGGTTTTAATGCCTTTTAATGCTGTTTGATCAGTTATCTCACATAGAAGTACTGAAGACTTTGAACAGCAGTGCACATATTCAGGAACTTATTTTTGGTCAGTTGTTTTGGAAAAACAGTTCAGTATTGTCATGCATTAATTGGTTGACATTTTCATGTCTTTATCTCTGTT[A/C]GATTAACCGTGAACTGAAGAAACACCTGAGGTTGAATGCAAACGCTTTAGTGATACACCACCGGCAAACTGGATACATGGACCTGGTCACCGAATCACTTCTTAATGAGTATGTCATCTTCAGGCTATCGGTGCGGTCAATATTTAGTTTGAAGGACTTTTAACATGAGATCTTTATTTAGTGTCTGGTAATTTGTTGGGATTTACAGTCACTTTTAACGTCATAATAGAAAATAGCATTTAAAGGGATAGTTCATACAAATATGATACTTTACTCAACCTTCACTTGTTCCAAAGCTGTTTGGGTGTCTTTTTGATCTGTTGAACATAAAAGAAGATATTTTGAAGGGTGTATTATTGCTGTGAATAGCATGGCAAGTCCTTTGTAAAATGTATAAAATGTACCGGAGTCTATTTTGTACTAGTAATTACTTTTCCTATTTCCCATTAGCTAAGTAATTCCTTAAATGCTACTGTCTTTTTTCTACCACTTATTCACGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461