Busch Lab

ZMP

SHROOM2 (1 of 2)

Ensembl ID:
ENSDARG00000076416
Description:
shroom family member 2 [Source:HGNC Symbol;Acc:630]
Human Orthologue:
SHROOM2
Human Description:
shroom family member 2 [Source:HGNC Symbol;Acc:630]
Mouse Orthologue:
Shroom2
Mouse Description:
shroom family member 2 Gene [Source:MGI Symbol;Acc:MGI:107194]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa2290 Essential Splice Site F2 line generated Not yet available
sa31513 Nonsense Available for shipment Available now
sa38554 Nonsense Mutation detected in F1 DNA Not yet available
sa943 Nonsense F2 line generated Not yet available
sa11469 Nonsense Available for shipment Available now
sa40712 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2290
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Essential Splice Site 245 1324 2 12
Genomic Location (Zv9):
Chromosome 6 (position 30120613)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30445508
GRCz11 6 30432422
KASP Assay ID:
554-2570.1 (used for ordering genotyping assays)
KASP Sequence:
AGTGATAGCTTTGCAGCTACCAAGGTTCAYGAGAAGGGTCTGATCACAGG[T/C]ACTTCAGAGGGCCTTGGTGGTCATTCTCAAGTAAAGCCTCAAGCGAAACC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31513
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 508 1324 4 12
Genomic Location (Zv9):
Chromosome 6 (position 30121652)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30446547
GRCz11 6 30433461
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACATGAAGCCCTTGACAGTCTCAGTAGTAAACAGGTTAGACGGAATGAC[C/T]GATTTGCCACCACTTTGCGCAACGAGATCCAGATGAGAAGGGCGCATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38554
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 801 1324 4 12
Genomic Location (Zv9):
Chromosome 6 (position 30122532)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30447427
GRCz11 6 30434341
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGAGCGACGGAGTAACCCCACCTGTGTGCATGAAAGATCTAGATCCT[C/A]ACCTTCTGCTGACTTTTATGGGCAGGTTTGTGACCTTGTTTAAATGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa943
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 831 1324 5 12
Genomic Location (Zv9):
Chromosome 6 (position 30123003)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30447898
GRCz11 6 30434812
KASP Assay ID:
554-0848.1 (used for ordering genotyping assays)
KASP Sequence:
AAGAAAAGAAGTCAGCTGACTGTTTCAAATCTGAAAAGAGTCCTTGCCAA[C/T]AGGACAAGAATAGTACAAGGTAGGTGCTGTTTCATTTTCCCATTGCACTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5370
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 1074 1324 8 12
Genomic Location (Zv9):
Chromosome 6 (position 30129939)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30454834
GRCz11 6 30441748
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTGATGGAGGGGATTTTCCCTCAAGGAGATCAGCTACTGGAGGAGGCC[C/T]AACAGCGYAGGAARGCTCAACCTAAACCACTCTCCCCTCGAAACTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11469
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 1075 1324 8 12
Genomic Location (Zv9):
Chromosome 6 (position 30129942)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30454837
GRCz11 6 30441751
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATGGAGGGGATTTTCCCTCAAGGAGATCAGCTACTGGAGGAGGCCYAA[C/T]AGCGYAGGAARGCTCAACCTAAACCACTCTCCCCTCGAAACTCTGTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40712
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Essential Splice Site 1146 1324 11 12
Genomic Location (Zv9):
Chromosome 6 (position 30139445)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30463312
GRCz11 6 30450226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTTCCTACCTACCAGTTGACTGAATCTAATGGCATTCTCTGTCTTTGC[A/T]GCACGAGTTGATTGAAAGTCTCAGTAAGAAGTTGCAGGTCTTAAAAGAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5371
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 1150 1324 11 12
Genomic Location (Zv9):
Chromosome 6 (position 30139459)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30463326
GRCz11 6 30450240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTTGACTGAATCTAATGGCATTCTCTGTCTTTGCAGCACGAGTTGATT[G/T]AAAGTCTCAGTAAGAAGTTGCAGGTCTTAAAAGAAGCTCAGGAGAGCCTG
Associated Phenotype:
Not determined