Busch Lab

ZMP

CORIN (1 of 2)

Ensembl ID:
ENSDARG00000076412
Description:
corin, serine peptidase [Source:HGNC Symbol;Acc:19012]
Human Orthologue:
CORIN
Human Description:
corin, serine peptidase [Source:HGNC Symbol;Acc:19012]
Mouse Orthologue:
Corin
Mouse Description:
corin Gene [Source:MGI Symbol;Acc:MGI:1349451]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14780 Nonsense Available for shipment Available now
sa3237 Essential Splice Site F2 line generated Not yet available
sa37793 Nonsense Mutation detected in F1 DNA Not yet available
sa37792 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14780
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Nonsense 71 275 2 6
Genomic Location (Zv9):
Chromosome 23 (position 44220454)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44185046
GRCz11 23 43986552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAGGTGGTTCTGGGCATAAATAATCTGGATCATCCGTCTCCATACATG[C/T]AAACGCGGCGAGTCAAGAGCATCATCGTTCACTCGCGCTACAATCGTGCS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3237
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Essential Splice Site 141 275 3 6
Genomic Location (Zv9):
Chromosome 23 (position 44220114)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44185386
GRCz11 23 43986892
KASP Assay ID:
554-3275.1 (used for ordering genotyping assays)
KASP Sequence:
TMTGAGCACAAGGTGANCAGGCACTTTTTTTTCTTTAATAACTGTTTTAG[G/A]TAATTCTACAGTGAGTCTGTGGTGTCAGTAGTGAGCCTTTGACATCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37793
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Nonsense 177 275 4 6
Genomic Location (Zv9):
Chromosome 23 (position 44217948)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44187552
GRCz11 23 43989058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTACTTTGACATGAAGACCATCACCTCTCGCATGCTCTGTGCTGGATA[C/A]GAGGCCGGAACCATCGACTCCTGTATGGTGAGTGAGGCTGTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37792
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Essential Splice Site 187 275 5 6
Genomic Location (Zv9):
Chromosome 23 (position 44217770)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44187730
GRCz11 23 43989236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCATACTTAATCATGAATGTGCACGTGTTTGTCTGTTTATATGTGTTC[A/G]GGGTGACAGTGGCGGTCCGCTGGTCTGCGAGGAGGACGATGGACACTGGT
Associated Phenotype:
Not determined