Busch Lab

ZMP

ARHGEF5

Ensembl ID:
ENSDARG00000076383
Description:
Rho guanine nucleotide exchange factor (GEF) 5 [Source:HGNC Symbol;Acc:13209]
Human Orthologue:
ARHGEF5
Human Description:
Rho guanine nucleotide exchange factor (GEF) 5 [Source:HGNC Symbol;Acc:13209]
Mouse Orthologue:
Arhgef5
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 5 Gene [Source:MGI Symbol;Acc:MGI:1858952]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa42696 Nonsense Mutation detected in F1 DNA Not yet available
sa22801 Nonsense Available for shipment Available now
sa5888 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14719 Nonsense Available for shipment Available now
sa36092 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28630
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Nonsense 453 1489 1 14
Genomic Location (Zv9):
Chromosome 16 (position 19678551)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17708874
GRCz11 16 17613892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAGGAGGACTACAGAGACAGAGAAAGAGCACGGGAGAGGTACAACCAA[A/T]GATTCAAGGAAAGTACGAAGTATGAAGAAGATCCTGCAAGAAATAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42696
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Nonsense 537 1489 1 14
Genomic Location (Zv9):
Chromosome 16 (position 19678803)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17709126
GRCz11 16 17614144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGGTAATAACATGGAAGTTAATGAAAGAGAGGAAGAGAGAAGCATTGAT[C/T]GACACGACTACTCAGGAATTGAGGAAGGAAGTGAGGGAGAATCAAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22801
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Nonsense 572 1489 1 14
Genomic Location (Zv9):
Chromosome 16 (position 19678908)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17709231
GRCz11 16 17614249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACAGAATAATATCAGCAGATGATGGATTTGTGACAGTCTCTAGTGGA[G/T]GAGATATTGAAGACTGTATGGATTTCCGGAATGGTGAAGTTCCCACTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5888
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Essential Splice Site 964 1489 3 14
Genomic Location (Zv9):
Chromosome 16 (position 19683636)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17713959
GRCz11 16 17619073
KASP Assay ID:
554-3909.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTTCAGGAAACTTGGGAGGACAAAAAAGAGGAGTTCTAAATACTTTAG[T/A]AGGTGTTTGTGTTTTTTCATATACATGGCAAACCCTGTCTATTACAGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28631
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Essential Splice Site 1258 1489 8 14
Genomic Location (Zv9):
Chromosome 16 (position 19690858)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17721181
GRCz11 16 17626290
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCAAAGATGAAGTGCAGGCCATTAAGGCCATGAAACTACTTGAGAAG[G/T]TGAGACTTCTATTGATGTTCTTGGAACAATGTAGTTGTCACTTACATAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14719
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Nonsense 1379 1489 11 14
Genomic Location (Zv9):
Chromosome 16 (position 19692179)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17722502
GRCz11 16 17627611
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATTCCTTACAGAAAAACCTGTTCCGTCTGCACATGCCACAAAAAGCCT[T/A]GCTTTTGCGAACAGATACCCAGTAAGTATGCMATTGTGCTTGCTTGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36092
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Essential Splice Site 1445 1489 13 14
Genomic Location (Zv9):
Chromosome 16 (position 19694575)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17724898
GRCz11 16 17630007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTTAGAGAAAGCTGATGTCCTTGTAGTTCACCAGCAAAGTAGTGATGG[T/A]GAGTTAGAACACTAAACACATTAACGAAAAATACCCCTATATATTTATCA
Associated Phenotype:
Not determined