Busch Lab

ZMP

si:dkey-178k16.1

Ensembl ID:
ENSDARG00000076364
ZFIN ID:
ZDB-GENE-090312-61
Human Orthologue:
EPB41L1
Human Description:
erythrocyte membrane protein band 4.1-like 1 [Source:HGNC Symbol;Acc:3378]
Mouse Orthologue:
Epb4.1l1
Mouse Description:
erythrocyte protein band 4.1-like 1 Gene [Source:MGI Symbol;Acc:MGI:103010]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa10149 Nonsense Available for shipment Available now
sa14559 Nonsense Available for shipment Available now
sa29886 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37633 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24269 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10149
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Nonsense 77 877 3 22
ENSDART00000134652 Nonsense 77 518 4 14
ENSDART00000143481 None None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12010256)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11969058
GRCz11 23 11904028
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTGTGCTCTTTYTCTGCTCATCAATCAAAACAGAAGCTCTGTAAAGGA[C/T]AAGTGTTACTGGATATGGTGTGTGAACATCTCAACCTGTTGGAGAAGGAC
Long Flanking Sequence:
AATAAAGGCACCGCCCTCTTCAGAAAGCTAATTTGCATTTAAAAATACACATACAAAACAGTGTGTTTTTGCTCACACTTAAAGAATGTAAACTTGGACTTTGAAAATGCACAAATAAATGGATCTGTGGAGTATTTTGAATTGACACATTCTGGGGACATCAGAGACTTAGAGTATTTTACATATTGTCAAAAGTCATAAATCTTTTCATACTTAAAAATATTCATAGCGCAAACATTTCAAATCAACATCTATATGACCCTGGCTATCAAATATGATGTTTACTAAATCTCCAAGACATCTTTCCATGACTTGATAAAAACCCAGGTATTATTATTTACTCAAGGAAAAGATACTATGCCCTAGTAATGACAAAGTGACCCTCCTGACTTTGATTAAAAATGGTAGGGGCATTTTCTACAACGACCAACACTTAATCAATCTCTTTTCCTTTGTGCTCTTTCTCTGCTCATCAATCAAAACAGAAGCTCTGTAAAGGA[C/T]AAGTGTTACTGGATATGGTGTGTGAACATCTCAACCTGTTGGAGAAGGACTACTTTGGTCTGAGCTTTAGTGACACGGAGTGTCAGAAGGTAAGAGTTCATCTCTTATATCACTTAATTGCACTATTTTACTTGCATAATTATAAAATTGCTTTAAGTGAATAGTCCACCCAACTATGAAAAAACACTGGTAATTTAATCAACTTCAGGCCATCTAAGTTATAAACATAAAAAAAAAACAACTAGCTTAAACTGTGTGTAATTCATGAAATGCAACAGGTGTCATTTCAATTTTAAAATGCAGATAGAGACAACACAAAATTCTGGCAACTTCTGATGATACGTTTAGATCTAAGTGAAACATTTGGTCTTTTAATGAAATTAATCAGTATTTAAAACATTTTGACTTGTAATCTACCTCTCAGTCAACACGTTCTTTAGCATAACACATGAAAACTGAACTGATGCCACTCAGTACACCTCCAAACATTGGCATCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14559
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Nonsense 124 877 5 22
ENSDART00000134652 Nonsense 124 518 6 14
ENSDART00000143481 None None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12004037)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11962839
GRCz11 23 11897809
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAATCTGTTGAACACRAGCTTGTRTTTGATTGTTTTTAGTKGGTCCTTG[G/A]CATTTCTCCTTTGCTGTCAAGTTCTATCCCCCTGATCCGTCTCAGCTGAT
Long Flanking Sequence:
ATTTGATTCTGGCTTTTGCATTTTACATGTATCAGTGGTCATTTATGAATGCTGGCACTGAGAGATGTTAAGAAGGCCATTCTTTTCATGTCCTCTGGAACGAGGTGAGCTGGCATTAAACGTTTTTGTGTGTCACCAGGCTTTGGATGACCTTACTGGAGTGCGGTGTGCCGGAGATGACATTTATCTACTCTTTTAGTGCTCCTGTGGCTGTAGAATATTAATGCACTGACCATTTTATAGAATATGTATGAGGTGGTTGCTCCTGCCGTGGAGGAGATGGTGCTGAAACTGCGGCATTTGCTTATCACTGTGCCCTGCTTGATAGAGAATTTCTTGTTCTCGCTTTCAGAATTGGCTCGATCCTTCAAAAGAAATCAAGAAACAAATCCGTGGTAAGTGTCGGGAAATACCAACCTACAGGACTTTGACTTTGTAACCTTGGCTGCCTGAATCTGTTGAACACAAGCTTGTGTTTGATTGTTTTTAGTGGGTCCTTG[G/A]CATTTCTCCTTTGCTGTCAAGTTCTATCCCCCTGATCCGTCTCAGCTGATTGAAGACATCACACGGTGAGTGCACTGTTCAAACTTGTTAAAGATGAAATGTGTAATTTCTGTGCCACTAGCATCACCAGATGTAAGTGCAAAAATAAAGACGGTCTGCAGAATACGCCCACTGTCTGCCATTGGGCAGCAAAACAGATAGTACCTCCCACACTTAATGCAATTGGTTGAGCCAGTGTTGCTGTGCTATGCCTGAAGCTTTTAGTTGCAAACTGCATATTATTTGAATTAAAATGTAAACGTTTTAATAATTATTCTTGTGACTGCAAAGGAAAATAAATTTTACTACTGCTACTCTACTACTACTAACAACAATGGTGTATAAAATATATCTACAATCTACAAATGCAACAAAAAGTCATGTTGTAGAATAATTTATAGGTTGTCCTTAGTAGGATGTTAAAAAGTGTATTAATGTTTTATTTCCATGTTGAATCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29886
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Essential Splice Site 146 877 6 22
ENSDART00000134652 Essential Splice Site 146 518 7 14
ENSDART00000143481 None None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12002601)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11961403
GRCz11 23 11896373
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATAATTTGTTAAGTTAGTTAATTTGTTGCATGTGTGTTTGCATGGGC[A/T]GGTATTACCTGTGTCTGCAGCTGAGGGAGGACATTCTGTCAGGTCGTTTG
Long Flanking Sequence:
TAGGGTAATTAGGCAAGTTATTCTATAACGATGGTTTGTTCTGTACACTAACGGAAAAAAAAAAATAGCTTAAAGGGCCTAATAATTTTGTCCCAAAAATAGTTTTTAAAAAATTCAAAACTGCTTTTAGGCGAAATAAAACAAATAAGACTTTTTCCAGAAGAAAAAAATATTATCAGACATACTGTGAAAATTCCCTTGCTCTTTTAAATACCATTTTGGGAAATATTTAAAAAAGAATAAAAAAATCAAAAGGGGGCTAATAATTCTGACTTCAACTGTATATATATATATATATATAATGTATATATAATGTATATTCGAGTCCTGATTGAGAGGTAACGTCCAATTTCTGATTATGTGATCGGATCTTCACATCCCTACCTTTTGCTTTGAGGCGACAGTGCTAACCACTGAGCCATAGTGTCTCCTAGTTTAAATTATTTTAAATTAATAATTTGTTAAGTTAGTTAATTTGTTGCATGTGTGTTTGCATGGGC[A/T]GGTATTACCTGTGTCTGCAGCTGAGGGAGGACATTCTGTCAGGTCGTTTGCCCTGCTCGTTCGTCACTCATGCTCTACTGGGCTCATACGCCATTCAGGCTGAGCTGGGAGACTATGACCCCGAGGAACACGGGCCAGACTACATCAACGAGTTCCGCTTTGCCCCCAATCAGACTCGCGAGCTGGAGGAAAGGGTGATGGAGCTGCACCGCACCTACAGGTGAGAGAGGTACACACACAGACACAGCAGGAATTATCAACGCTGTCAATTAATTAACAATTATACTCATATTACTCACATGATATGCTAATTAATTTAATTAAACCCAATTAATCACATTAATCAGTGTTTGCTGAGTCCCACGCATGATGATACTGTGAATACATTACATTAGTATAAGAGACAATTAAAGCGTTGAAAATACTGAAGTTAAAAGGAATGATGCTTGTTTTAAAAGTTTTTAGTTATTTTGGTCATGTGATAGAATACTCATAGAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29885
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Essential Splice Site 390 877 10 22
ENSDART00000134652 Essential Splice Site 390 518 11 14
ENSDART00000143481 None None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11989786)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11948588
GRCz11 23 11883558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAACGATCCATTAGTAGAAGGTACCTGTTGTCCCGCAGCATAGACGGAG[G/A]TAAGTTTTCTCTAATAACATGTCTATATCAAAATATAATAATTTACCAAA
Long Flanking Sequence:
ATTTGTTTGTCCTGTGGACTTACAATAGCTGCTGTGTGTGCATATCTGTCCGCAACACCATAGGGTGTCCCATTCATCAACTTGACTTCCAGAAGGGTGTTTGCAAGGAACCTCTTTGTGGTCGTTGTGCACCCTCCATGTGCAATTCTGCCAAGACCACAACCCTTCACAGCATACTTCTATAAGCAGTCGTCAAAAAAAAAACATTATTTCACTGCAGACTAAGAGGAAGATAAGATGAGGGTTTAGAGTGCTATTTGAGACAAGCCCATTTTGACATGATACATACTTAAACTCAACATTATTTCTGTTTTTCTCCCATAGGTTGGTCTCTCCTGAGCCTCCCCCAAAAGGTTTTCTTGTGATTGGCTCAAAGTTCCGCTATAGTGGACGAACCCAAGCCCAGAGCCGACAGGCTAGTGCTTTGATTGACAGGCCAGCTCCTCAATTTGAACGATCCATTAGTAGAAGGTACCTGTTGTCCCGCAGCATAGACGGAG[G/A]TAAGTTTTCTCTAATAACATGTCTATATCAAAATATAATAATTTACCAAAATCATGTACTAGTACAAATTTTGATCTATTTTAATTATGTAGTGGTAAAGGATTTACCTCAGAATGCATTTGCCATTTCAATGCTTTCACATTCTACCAATGATATTTAGTTTAATACTATTTAATACAAACTTTCCAAAATAAGCACCATTTGACGGAAAGCACTGAACTAAAACACACATTAATTGCAGAAAATTTTAAGACTTGATTTACCTCCATTTTGATTTGATAACTATAAAAGCTGCATGATGAACTTATGTGTAAATAAAATCTAGTGTTTCAATTAAAAAATAACATGGAGAATCAACAAAAGAACATTATTTCCAGTGCCTAAATTTGATATGTCCAAGATCCCAGATTTGTGGTGTTGAGGTGCAGTTACATATACCATTGCTCACAGAAATTTCACAACCATTAAATTTACATTTCAATTAAATTTTAATATTAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19317
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Essential Splice Site 456 877 11 22
ENSDART00000134652 Essential Splice Site 456 518 12 14
ENSDART00000143481 None None 140 None 6
ENSDART00000110627 Essential Splice Site 456 877 11 22
ENSDART00000134652 Essential Splice Site 456 518 12 14
ENSDART00000143481 None None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11984246)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11943048
GRCz11 23 11878018
KASP Assay ID:
554-6184.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGCGACTAGAGAGTGACTCCACTCCCTCTAAAACGGTGGAGCTCAAGG[T/C]TCTGTGCCCACAGTGGTGTTTAATGTCTTCATTTAGTTGTGTTTTTCCTT
Long Flanking Sequence:
TAAATATATATATATAAATTGATGACGTTGTCAGAGAATATCTTAATAACATTAACATTCGTTGTAAAATGTGTGTGGTTCTGCAGGTCTGGATATTATTGCCTGAAGTGTCAAAGCCCTGCAAAGTTTAGTGCTAACCCTGCTTAACCACCCTTACCTGTAGGTTTCAAACAGCCTTGAAGGACTCAATTTAGTTTGATCAGGTCTGTTTAATTAAAGCTGAACTGTGCAGAGCTTTGGCCCTCCAGGAACAGAGTTTGACATCTGTGCTCTACATGGTTGCTGCTTTTCATTTTTTTTAGAGTCTGCTTTAGGGGACACCATGGACCGACTCTCTCAGCACACTTCCAGTGAGCCTGTGCCTAGTCTTCCTAGAGATGAGCTGGACCAGGACTACCTAGAGCCCAGTCTAGATCAGGACCTGGACCAAGATCATGAACAAGAAGAAGAACAGCGACTAGAGAGTGACTCCACTCCCTCTAAAACGGTGGAGCTCAAGG[T/C]TCTGTGCCCACAGTGGTGTTTAATGTCTTCATTTAGTTGTGTTTTTCCTTTTCTTATAATTTTTGAAGGTATTCCGTGGGAAACAAGCCATTTTAATTTATATGAAGTTCATAATGTATTGGTGGAAATTGTGTAAATGTTCTTCCTAGCATATTTAAACTACTAGACCCACTGACATTATTTAATTAACACCTCCCTTGCCGTCTTCTAATTAATACCGTCTCATACTCCAAGACCTTTTCCTACTTTTGCTTTTCTTTTCTGCCTCTGACTAAATTTCAAAAATATTTCTACGTCTGCTTGTTTTGTTAACATGTCTTTTGAATTTAACTTTTCAACCTCTTTGCAAACCTCCCCTCCTCTCCAATTGCTAATTTCCTCAGTCTAATTCAGATTCTGCACTTTTCCCCGTGCTTCTAACGCTTCACTGCTGTCCTCTAACTATCGCTTCTCTTTTCATCTTCTCGCGGACAGAGGGAGGAGGCAGGTTCTCCTGTAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5033
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Essential Splice Site 456 877 11 22
ENSDART00000134652 Essential Splice Site 456 518 12 14
ENSDART00000143481 None None 140 None 6
ENSDART00000110627 Essential Splice Site 456 877 11 22
ENSDART00000134652 Essential Splice Site 456 518 12 14
ENSDART00000143481 None None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11984246)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11943048
GRCz11 23 11878018
KASP Assay ID:
554-6184.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGCGACTAGAGAGTGACTCCACTCCCTCTAAAACGGTGGAGCTCAAGG[T/C]TCTGTGCCCACAGTGGTGTTTAATGTCTTCATTTAGTTGTGTTTTTCCTT
Long Flanking Sequence:
TAAATATATATATATAAATTGATGACGTTGTCAGAGAATATCTTAATAACATTAACATTCGTTGTAAAATGTGTGTGGTTCTGCAGGTCTGGATATTATTGCCTGAAGTGTCAAAGCCCTGCAAAGTTTAGTGCTAACCCTGCTTAACCACCCTTACCTGTAGGTTTCAAACAGCCTTGAAGGACTCAATTTAGTTTGATCAGGTCTGTTTAATTAAAGCTGAACTGTGCAGAGCTTTGGCCCTCCAGGAACAGAGTTTGACATCTGTGCTCTACATGGTTGCTGCTTTTCATTTTTTTTAGAGTCTGCTTTAGGGGACACCATGGACCGACTCTCTCAGCACACTTCCAGTGAGCCTGTGCCTAGTCTTCCTAGAGATGAGCTGGACCAGGACTACCTAGAGCCCAGTCTAGATCAGGACCTGGACCAAGATCATGAACAAGAAGAAGAACAGCGACTAGAGAGTGACTCCACTCCCTCTAAAACGGTGGAGCTCAAGG[T/C]TCTGTGCCCACAGTGGTGTTTAATGTCTTCATTTAGTTGTGTTTTTCCTTTTCTTATAATTTTTGAAGGTATTCCGTGGGAAACAAGCCATTTTAATTTATATGAAGTTCATAATGTATTGGTGGAAATTGTGTAAATGTTCTTCCTAGCATATTTAAACTACTAGACCCACTGACATTATTTAATTAACACCTCCCTTGCCGTCTTCTAATTAATACCGTCTCATACTCCAAGACCTTTTCCTACTTTTGCTTTTCTTTTCTGCCTCTGACTAAATTTCAAAAATATTTCTACGTCTGCTTGTTTTGTTAACATGTCTTTTGAATTTAACTTTTCAACCTCTTTGCAAACCTCCCCTCCTCTCCAATTGCTAATTTCCTCAGTCTAATTCAGATTCTGCACTTTTCCCCGTGCTTCTAACGCTTCACTGCTGTCCTCTAACTATCGCTTCTCTTTTCATCTTCTCGCGGACAGAGGGAGGAGGCAGGTTCTCCTGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37633
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Essential Splice Site 532 877 14 22
ENSDART00000134652 None None 518 None 14
ENSDART00000143481 None None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11981760)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11940562
GRCz11 23 11875532
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAACGTCTCTCTGGAGCCTCATCTGGTAGCACTCCGGAGAAAAAATCT[G/T]TGAGTAATTGGTACCAGCAAGGGGAAGTATTTTGTGGTGACTTCAAAAAC
Long Flanking Sequence:
ACAGTGTTTACACAGTATTTCAAAGTGTTAGACTTAGTTAGGTAAAGAGGAATAATGTGCAATGCAAACTAATCAAACAGATCACTTGATACACTTTAGTGGCATTTGATGTTGGCTTATTGAAGTTTTTAATCATTTCAACATGCAATTCTAACTTTGGGACTAATTCTGGTAAAAGAATAGAACTCAACCAATGATTCTCAAGGGCATATGTTTGCATTCATGTACTTATTATGTACCACAGTTAGATAACATTTGTAAACAGCTGTGAAGGTCACCGGACAGCTTTCACTTAAGTAATTCACTTGAGGTAAGTGGTTCTACCGATTGACTTGTTTGTTTTATAGCAGTTCCTGGATAAACCAGAGGATGTGTTGCAGAAACATCAAGCCAGCATCAATGAGCTGAAAAGAGCGCTGAGGGAGCCCAACAGCAAACTGGTCCACAGAGAAAAACGTCTCTCTGGAGCCTCATCTGGTAGCACTCCGGAGAAAAAATCT[G/T]TGAGTAATTGGTACCAGCAAGGGGAAGTATTTTGTGGTGACTTCAAAAACCCAAAAACAGATGCTATGTGATTAGTTTATTTCGGTCTGATACTGTTTTAAGATTCGCAACGAGGATTATTCAGATTTGTGTCAGCACCAGTCTCAGATTTAGTGTGCCAAATGCTTGATTTGTTATTCATGCCCTCTTTTTTATGTGACTAATCTCTCTTTAAGTGGATGCTGTTGAACCATTTCATGTCATGCCTCTGGGTCAAGAGCTAGCAGCAGTTTGAACTTTAATAGAATCTGTATGAAGTGGTTTATTTGAACACAGCATGAATGCATTTTCCTTAATTAGTGTTATAAAGACAATGATATTGCTTGATAATAAAAGCAAATGGCATTTTAAGTACTTAAGTACATTACTGTCTCTCTTTTTTATTTACCTTCAAAACATCCATACAACATTTTACATAAAATTCAACTTGAGATCATTCTTTACCTTCACAGGTCATTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24269
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Nonsense 716 877 17 22
ENSDART00000134652 None None 518 None 14
ENSDART00000143481 None None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11977256)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11936058
GRCz11 23 11871028
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTACAGAACAAGCTAATGCCCAGTCGATGAGACGGGAGAGCTCTGAAT[C/A]ACCCCCAATCCACCCTCTCAGCAGAGAGAGCAGTGAAATCATTGCCTCCC
Long Flanking Sequence:
GGAGGTAGACAAGTATAATAGTGCTTTCAGCAAAGTAACTGACTCTTCCAATCACTGGTCACAATAAATGTGTTGATGAATGCAATCACGTCCCATTTTTCTCGCGTTCTACAGGGCATCAGAACCAAAGCATGAAATTACATTGGAATTTGAGTTCATGATTGATGCTAATTCCATTCCATTTGATGCTGCTCTCCATAGTTCAGTCAGTCAGTTCAGGTTTGGTTTCTTTGATTTCAGAATTTTGTTACATTTTTTCATTGCTTCTTATTCTTTTCTTTTGAACCATGACTCACCATATGCTGCCAAGTTCATTTGATTGGCATTGTGTTCCTTATATCTCATGATCACTCCCAGGTTTTCACTTGATCTGTTTCATTTCTTTCTCAAGCCTTTTGTACCCAAGAAAGCTCCACGGTCGGTGAAAGCTGCACAGGCCCTAAGAAAAGACTCTACAGAACAAGCTAATGCCCAGTCGATGAGACGGGAGAGCTCTGAAT[C/A]ACCCCCAATCCACCCTCTCAGCAGAGAGAGCAGTGAAATCATTGCCTCCCAGGCTCTAAGGAAGACTGAGGTCAAGATCGAGACGCAGCCCAATGGCTCAGAGGTCACCACAACCATAATGGAGATTGCAGACCCGGTAAAGACCTTTTAGCTCATCAAATGTACTTTACCGGGGAAGTGTCACTATGTGACAGGTTCAACTACAGCAGATTTTGGCCCTCGTGTGCCACTATCCTGCGGAGTTAAGCTCCAATCCTAATCAGACATACCTGCCTGTATAAAGTAGCTTTCTAGTGATCTTGAAAACATTGATAAGCTGGTTCAAGTTTGTTTGATTAGTGCTGGGGCAAAACTCTGCAGGATAATGGCCCTCCAGAACCAAAGTTGCCATCCCTAAATTAGAGGGACATGCTTTAAAGATTGTAATTAAGTCAATTATCATTTATTCCTTATCTACAGTAAGTGTCCTTACTTTATTTTATTACTTCCATGCACTGTAG
Associated Phenotype:
Not determined