Busch Lab

ZMP

mylk3

Ensembl ID:
ENSDARG00000076348
ZFIN ID:
ZDB-GENE-030131-3497
Description:
myosin light chain kinase 3 [Source:RefSeq peptide;Acc:NP_001099057]
Human Orthologue:
MYLK3
Human Description:
myosin light chain kinase 3 [Source:HGNC Symbol;Acc:29826]
Mouse Orthologue:
Mylk3
Mouse Description:
myosin light chain kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2443063]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45291 Nonsense Mutation detected in F1 DNA Not yet available
sa27022 Nonsense Mutation detected in F1 DNA Not yet available
sa18088 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27023
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109918 Nonsense 207 715 4 13
ENSDART00000142981 Nonsense 207 690 4 12
Genomic Location (Zv9):
Chromosome 7 (position 44576702)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41567002
GRCz11 7 41847075
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGACAACAATTGGAGAAGATTGAGGATCCTCAACAACAGGCAGAGGTTT[C/A]ACTGTTTGTTGATGAGGATTCGTTAGAAAAATCAGTTCCTGGACAACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45291
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109918 Nonsense 408 715 5 13
ENSDART00000142981 Nonsense 408 690 5 12
Genomic Location (Zv9):
Chromosome 7 (position 44574563)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41564863
GRCz11 7 41844936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGTGCCAAGCAGGTTCCCATTAACTCATATTATGCTGTCAACCCTGTC[G/T]AGGTTCTAGGCGGGTAAGTCCATGTGTTATAAGCAGTTAATTCACCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27022
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109918 Nonsense 489 715 8 13
ENSDART00000142981 Nonsense 489 690 8 12
Genomic Location (Zv9):
Chromosome 7 (position 44564932)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41555232
GRCz11 7 41835305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGTCCATGGTTTGTTATTGCAGCGTGGAGGGCGGCGAATTGTTTGAA[C/T]GAATCATTGATGAGAGTTACCAGCTGACGGAGCTGGATGCCATCGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18088
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109918 Essential Splice Site 594 715 11 13
ENSDART00000142981 Essential Splice Site 594 690 11 12
Genomic Location (Zv9):
Chromosome 7 (position 44555400)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41545700
GRCz11 7 41825773
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
RAGGGTGAACAGATTTAAGTTATTTTYACYCTCTGTGATTTCATTTTTTC[A/T]GTTTGAGTGGCCTTTCTCCATTCMTGGGTGACAACGACGCAGAAACAATG
Associated Phenotype:
Not determined