Busch Lab

ZMP

zgc:162883

Ensembl ID:
ENSDARG00000076338
ZFIN ID:
ZDB-GENE-070410-101
Description:
inositol polyphosphate-5-phosphatase K [Source:RefSeq peptide;Acc:NP_001082962]
Human Orthologue:
INPP5K
Human Description:
inositol polyphosphate-5-phosphatase K [Source:HGNC Symbol;Acc:33882]
Mouse Orthologue:
Inpp5k
Mouse Description:
inositol polyphosphate 5-phosphatase K Gene [Source:MGI Symbol;Acc:MGI:1194899]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa42586 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35940 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1619 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42586
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111434 Essential Splice Site 5 456 2 13
ENSDART00000115176 None None 455 None 12
Genomic Location (Zv9):
Chromosome 15 (position 32030355)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33986192
GRCz11 15 33844171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAATACTGTCCGTTTGGAGACGAAAGATGGCAAGATGGAGAATTTCGG[G/A]TATGTTTTCACGTCTAGCTTTCATTTAGCATATGCCTTCTCATATTAAGT
Long Flanking Sequence:
GAGACTGCGGAGAGAAGGCAAACGACAAGGCTTTATCAGGTAGTTTGAATACTGTTAAACATATTCATCCTGGATCATAACATAGTATTATTATTTTGACATCTCAGTATGTAAGTTACAGTAATAGAAGAAGTTTTGCTTTAATCTGCACTTTAATCAGTCTTTGCAACTCTGTGTTATGAGTTTGATAGTATTTTTCATTGAATATTATCATGGCGTAAAATTTTATATTCAACATGTTATATTAAAAAACAGCAATATTTGAGAGACGAATTAATCTTATGGTCGAAGTCATATAATTTACATTAACTACACTTTGCATTTAGCGGCCCTTATTTTGTTAAAGAGAATATAGTTTTTGCTGTATAAAAACACGATGACGGATTTAATGTGATGCACACGATGTTATGATTGACAGGCGAGAGGATGGAGGAAGATTTGTCTCGTGCTTTGAATACTGTCCGTTTGGAGACGAAAGATGGCAAGATGGAGAATTTCGG[G/A]TATGTTTTCACGTCTAGCTTTCATTTAGCATATGCCTTCTCATATTAAGTTATGGATATTGCATTTTAATAATGTTAAGGGGCACAAAAGGAAGTATTCTCATTATGTAATGATCTGATGTTGATATACAAAGATCCATTCAGATTTTTCTTCAGCACAAACAAGTGTGTAGATGGTGTATTTTTTGTCACAAGGTTGTTTGTTAAAGAGCTTTTTTCCCCCATTTCAACATCCAGAATTCTCACACGAGGAGAACAGTTCAGTCTGTTGTTTGCTGAAATGGTGAAAGAATAAAGTAGGGATAAGCACTTTGGGATTAGCTTTCTCAAAACACTTTGGTACAACAGGTTTCTAGTCATGTGGAGGTTTGTGGGAAACCAAACAGTTTTACAGTTCCAGATTTTGGCCAACAGTTTCATAACAATATATGTGATGTAAACTGAATAATTTCTATTCAAGATCTTCAGGAATAAAAACATCACAGTTTTATTTGTAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35940
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111434 Essential Splice Site 248 456 8 13
ENSDART00000115176 Essential Splice Site 247 455 7 12
Genomic Location (Zv9):
Chromosome 15 (position 32020766)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33995781
GRCz11 15 33853760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAGCCCACCTACAAATTTGACTTGAACTCAGACAACTATGACACAAG[G/A]TACATAACACAATGTGTTCACAATATATCCTGCAGTGTATCTTACTTTCA
Long Flanking Sequence:
CAACAATGCTTATTAATGTATGATAGTAAAAATGAGAGTAAAAAAAAGAAAGAAAGGACAACAGTAATAAATGACAACAATAATAATACTTAACAATAAAGACTTTGCTGTTTTTAATTTGATTGTGTCGTTTTCATTCTTTGTAGGATTGTAATCTTTCCTTCACTAAAGTAATTTAGTTCATATTCTTTAACCTTTGTATTTTTGCCTGATCTTTATACTGTATACTTCATTTCTTAAGTATTTGTGATGTTATGATTCTCCTCACAACTTGTTAGTTTTGGTTCATGGCTTATAACGCCTTAGCAAAGACTTTGAAAGTCCCTTGTGTTTGTTCACTGATGTACTTAAAGATTGTTGACCCATCTGTTGATGTTTCTGTCTCACCAGCTCACCATGATGAAACAGAAGGAAGTTATTTTGCAGAAGTTTGAAGAGGGACCGCTGGACTTTCAGCCCACCTACAAATTTGACTTGAACTCAGACAACTATGACACAAG[G/A]TACATAACACAATGTGTTCACAATATATCCTGCAGTGTATCTTACTTTCATACAATCATTTATTTACCTAACACAAATGTAGCTTATCAGACTGTTAGATCTCACTTCTTCATAATGTCAGACTGAACAAAAATCAAGTGCCAAACACGGACACAAGCACGATCTGGAGTCTGGTGTCATCAATTGTTCATTCATTTCCACACTAATATGCTTTTGTTTAAAAACACAATTTTTTTTATTGTCTATTGTTTTTAGAAAACAAAAATGTATCTTTTTAAAAACACGGTTGAAAGTGGAGTGATTTGAAAATGCAGTTTTCATGTTGCAGTATGGACTGTGAAAACGGAGGCTTTAGAAAACAATGATGTATTTTAGTCATGTGACGCAGTCATGTGACCAATTTAGCTAACATTGTAGATGGCGTTGTGAAGCAGATGTTTTATATGCTGTCTGTTTTTACAGCTTTATTAAAGATTAATGCAAGTTTGTACATGCTCCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa590
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111434 Essential Splice Site 396 456 12 13
ENSDART00000115176 Essential Splice Site 395 455 11 12
Genomic Location (Zv9):
Chromosome 15 (position 32012514)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34004033
GRCz11 15 33862012
KASP Assay ID:
554-0500.1 (used for ordering genotyping assays)
KASP Sequence:
TTTAATATAATCAACAGAGTCGATTCATATATTGCATTGTCATTTTTACA[G/T]GTTTATATGAACAAAGATGAAATTCCAGTTCTTGGGGGMGAGTGTGTGCT
Long Flanking Sequence:
TTATAAAAAGTATAATTAAAGGCACAGTATGTCATTTTAGCTGCTAGAGAGCTCATTCACAACAAACAAAAATGTAGTTTGATGTTGCTGTGAGTGTGGAATCATGGGAGTTGTGGTCTTAATTACATATTGTGCCTTCACAAGTTCAACAAAAGTGTATTCAATTGATTAACAACCACTGGCAGAACTCACAACAAGTCTGCTTTTAAAGTTTCATCATTTTCTGTAAAAAAAATATATATATATATTGTGAAAACGCAAATCTGAACCTGACTGCTGCTCTTGTGAAATGAGCTTTATCCAGGATTTTTGTAATACAGACCCGTTTGTCACCTCACAGGTTGGGTTTAAGAGTGTTTCCGACTACATCACGTATGCATGGGTAAAAGATGACCAGGTGTCTTTCAATGAGGAGCTCTTTCAGGTTTGCAAAATTTACTGTCTGTGTTTTTTAATATAATCAACAGAGTCGATTCATATATTGCATTGTCATTTTTACA[G/T]GTTTATATGAACAAAGATGAAATTCCAGTTCTTGGGGGCGAGTGTGTGCTGTGTTATTACAGCAGCAACCTGCAGTGTATTGTGGGTATTAGTCAACCTTTCAAGGTAAGCAACACGTCAGTTTTGCGTATTTATCAAACATCAAAATAATAAAAGTGTAATACAGCATTTGTGCATATAGAAATTGAATTATTTATTATTGTAATTTCTTGGAAGTAAACAATCATCATTCTCGTACTTAACTGTGAATTTAAAAATTGGAGTTCGATTTAAGATTTTTTTGCCACAAAGTGAGAGTAAAGCCCCAGTCAGATCACACGATTTTTATTGTCGGTTACGAAAGTCACTATGTCAGATTATGCATTTTTGTCTAGATAAAATCTTGACTTGTCGTAGGTTCCTTCACGATCAGTCATCCCGTGACGTCTACGAGCTTCATAAGCTATCAAAGTGTTGCTATAACAATATTTCCTATCTCAATTTTGATTTTTTTTTAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1619
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111434 Nonsense 420 456 12 13
ENSDART00000115176 Nonsense 419 455 11 12
Genomic Location (Zv9):
Chromosome 15 (position 32012441)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34004106
GRCz11 15 33862085
KASP Assay ID:
554-1560.1 (used for ordering genotyping assays)
KASP Sequence:
TTCCAGTTCTTGGGGGMGAGTGTGTGCTGTGTTATTACAGCAGCAACCTG[C/T]AGTGTATTGTGGGTATTAGTCAACCTTTCAAGGTAANNNNCACGTCAGTT
Long Flanking Sequence:
GTAGTTTGATGTTGCTGTGAGTGTGGAATCATGGGAGTTGTGGTCTTAATTACATATTGTGCCTTCACAAGTTCAACAAAAGTGTATTCAATTGATTAACAACCACTGGCAGAACTCACAACAAGTCTGCTTTTAAAGTTTCATCATTTTCTGTAAAAAAAATATATATATATATTGTGAAAACGCAAATCTGAACCTGACTGCTGCTCTTGTGAAATGAGCTTTATCCAGGATTTTTGTAATACAGACCCGTTTGTCACCTCACAGGTTGGGTTTAAGAGTGTTTCCGACTACATCACGTATGCATGGGTAAAAGATGACCAGGTGTCTTTCAATGAGGAGCTCTTTCAGGTTTGCAAAATTTACTGTCTGTGTTTTTTAATATAATCAACAGAGTCGATTCATATATTGCATTGTCATTTTTACAGGTTTATATGAACAAAGATGAAATTCCAGTTCTTGGGGGCGAGTGTGTGCTGTGTTATTACAGCAGCAACCTG[C/T]AGTGTATTGTGGGTATTAGTCAACCTTTCAAGGTAAGCAACACGTCAGTTTTGCGTATTTATCAAACATCAAAATAATAAAAGTGTAATACAGCATTTGTGCATATAGAAATTGAATTATTTATTATTGTAATTTCTTGGAAGTAAACAATCATCATTCTCGTACTTAACTGTGAATTTAAAAATTGGAGTTCGATTTAAGATTTTTTTGCCACAAAGTGAGAGTAAAGCCCCAGTCAGATCACACGATTTTTATTGTCGGTTACGAAAGTCACTATGTCAGATTATGCATTTTTGTCTAGATAAAATCTTGACTTGTCGTAGGTTCCTTCACGATCAGTCATCCCGTGACGTCTACGAGCTTCATAAGCTATCAAAGTGTTGCTATAACAATATTTCCTATCTCAATTTTGATTTTTTTTTAATCTTATTTCAACCTCAGTAAACACTGATGCTTGCTGACAATTAGGCTACATTATTTAAGGTAATTTGTTATGACAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461