Busch Lab

ZMP

A7MBS5_DANRE

Ensembl ID:
ENSDARG00000076332
Description:
LOC792773 protein [Source:UniProtKB/TrEMBL;Acc:A7MBS5]
Human Orthologue:
IGSF10
Human Description:
immunoglobulin superfamily, member 10 [Source:HGNC Symbol;Acc:26384]
Mouse Orthologue:
Igsf10
Mouse Description:
immunoglobulin superfamily, member 10 Gene [Source:MGI Symbol;Acc:MGI:1923481]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22445 Nonsense Available for shipment Available now
sa45510 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28283
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112149 Essential Splice Site 108 861 4 5
Genomic Location (Zv9):
Chromosome 14 (position 15449626)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17311612
GRCz11 14 17617265
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAATAAAATGAAGCATTTGAGAAATTTACGTTTTTTTTTTTTTTTGCTT[A/T]GATCCTCAAGTTGAGCTACAACAAACTGAAAAGAGTTGACCCCAGCTTAT
Long Flanking Sequence:
GAAATCTTTTAGAATTTACAAAATTTGTCTCAGATGACCAAATCCTGGCAGAAATTGCACAGTTTGAGCAGGGCTTCAGGGAAAATATAAATATGCATGTATAGGTCTCTATAGGTCTCCTTCGGAAGCTGTCAATACATTCCATTGTGTATTTGTTTTGTACCACTGTAGCATTGGGTTGCCACAATGATGTGAGATTTCTTAACATTCCCCATGATCAAATTTGTCTATTCGACAGCTATAACAGCATTGGGGCAGTTGGGTCTTCAGATTTTGTCAACCTACGGAAATTGGAAATGCTTATGCTTCATGGAAATGATATATCCTCTGTTTCTTCTGGATCCTTTTACCACCTCCGGTCCCTGCAGGTATATATTCATAAATAGTTATATGAGATCCACATTAAACACAGTGCACTTATCTACTGTATCATCTTTGTGTCTATACTTCCCAATAAAATGAAGCATTTGAGAAATTTACGTTTTTTTTTTTTTTTGCTT[A/T]GATCCTCAAGTTGAGCTACAACAAACTGAAAAGAGTTGACCCCAGCTTATTTGAGGGCTTGACTAGCCTCGTACGGCTTCATTTAGACCACAATCTCATTGACTTCATTGAGCCCTTTTCATTTAATGGACTCACATCATTAAAGCTATTGCAACTGGAGGGGAACCGACTGCAGGACCTCCATTCTCACACATTTATTACAGTCTCAGTTCTGGGAACATTTTGGAGCTCAGGACTGCGGCACCTGCACTTGGCAGACAATCAGCTAGAATACTTACTGCCTGGAACTCTGCAGCACTTAAACAGGCTGGAAGTCCTCTCCCTGCATGGAAACCCCTGGGCTTGTGATTGCCACTTACATTGGCTCTTGGAGTGGAACAAGAATCATGATGGTGAAACTTCTTTGATTGAATTTTTGACCTTTGCACCACTTACTAGGAATTTAGTGTATTGTAAAAGAAATTTAAAGAAACAAAAATCAGGAACACTTTACTTGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22445
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112149 Nonsense 644 861 5 5
Genomic Location (Zv9):
Chromosome 14 (position 15445554)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17307540
GRCz11 14 17613193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTTGATAATCAAAACAGTGACACACGAGGATGCTGGAGAGTACAGCTG[T/A]TTAGCAGCTAACCTGTATGGAGCTGATATGTTGTCTCATCTAATTGTTGT
Long Flanking Sequence:
CAAAGAGGAGCCCCAGGGAGAATCCAGTCAGTTCTAGAACATTATGAGGTTAGTCTGGATTGTAGCGTGCTCAGCTCAGGGCATTACCCTGTGGAGTGGATGCTTCCAGACTTAACACCGATCGATCAAACTGATTCTCATAATTTAAGGTTGGAGAATCACAGGCTAGTAATCAAAAACACAAGTATAGCAGACTCTGGACTTTATCATTGCTTTGTGAGGACTGACACTAATGTGGACATAGTCTCCTATAGGCTGACAGTCAGGATGCGCCTTTTGAGTCCCAGTGATTTAAATGGAAAAAAGATATCTGTGGAAAAAGGGGACACTCTTAATCTTCCCTGCTTAGTAACATCTCCTCATCCAATTGAGACAAAATGGTACCTACCAAACAATCAGATTCTCAAAGCATCAGAGAGAAAAGGAAATGTACAAGTATCACAGAACAACACGTTGATAATCAAAACAGTGACACACGAGGATGCTGGAGAGTACAGCTG[T/A]TTAGCAGCTAACCTGTATGGAGCTGATATGTTGTCTCATCTAATTGTTGTTACTGGTGAAAAAGAAGAAACACAAAGAGGTGTTCTGGTTTCCAAGGGCGAAGTACCACTTTTTGAAAGTGAGGGAAGTGAAGGGTCAGGTTATGAAGAAATCAAACGACCAACAGCTAAGCTCACACCTCAAAAGACTGATGGAAAACACAGGGGTGGCATCATCCGACAAAATACAAAAGGGAAGAAAGTCAAGGAAGGTGTAAGAAAACCAAATAACTCTGTCAAGGAGCTTGACCCTAGTCGCTGGGAGCAGATTGTTGCAAAAGCTAATGCTAAACTGTCAACTGTTCTGCCAGTTACAATACATCTAGAAAATGTAATAACAACAACCACCATCTCTTCGTCAGCCATTCAAACTGCTAAAACAGATGTTACTGCTAGTGGTGCCAGTACAACTTCAAGCCTACAACGTTTCAATGTGAAACAGCTGGAAACGGCACCCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45510
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112149 Nonsense 746 861 5 5
Genomic Location (Zv9):
Chromosome 14 (position 15445250)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17307236
GRCz11 14 17612889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGAAAACCAAATAACTCTGTCAAGGAGCTTGACCCTAGTCGCTGGGAG[C/T]AGATTGTTGCAAAAGCTAATGCTAAACTGTCAACTGTTCTGCCAGTTACA
Long Flanking Sequence:
AGATATCTGTGGAAAAAGGGGACACTCTTAATCTTCCCTGCTTAGTAACATCTCCTCATCCAATTGAGACAAAATGGTACCTACCAAACAATCAGATTCTCAAAGCATCAGAGAGAAAAGGAAATGTACAAGTATCACAGAACAACACGTTGATAATCAAAACAGTGACACACGAGGATGCTGGAGAGTACAGCTGTTTAGCAGCTAACCTGTATGGAGCTGATATGTTGTCTCATCTAATTGTTGTTACTGGTGAAAAAGAAGAAACACAAAGAGGTGTTCTGGTTTCCAAGGGCGAAGTACCACTTTTTGAAAGTGAGGGAAGTGAAGGGTCAGGTTATGAAGAAATCAAACGACCAACAGCTAAGCTCACACCTCAAAAGACTGATGGAAAACACAGGGGTGGCATCATCCGACAAAATACAAAAGGGAAGAAAGTCAAGGAAGGTGTAAGAAAACCAAATAACTCTGTCAAGGAGCTTGACCCTAGTCGCTGGGAG[C/T]AGATTGTTGCAAAAGCTAATGCTAAACTGTCAACTGTTCTGCCAGTTACAATACATCTAGAAAATGTAATAACAACAACCACCATCTCTTCGTCAGCCATTCAAACTGCTAAAACAGATGTTACTGCTAGTGGTGCCAGTACAACTTCAAGCCTACAACGTTTCAATGTGAAACAGCTGGAAACGGCACCCCACAGTGAGCATGTAAAACAAGAAACTACACATGGAGAGGAATCAAAACAGAAAATAGATGGTTACAACAATTCAGATTTGACAACAGCAGTGCCTGAACATGAGACACAGCTGGTGAAACAGGTAGACAGACACACAATAGAAGAGAAAATAAGGGCTAACAATAATTCCATCTGGAACCAAAGACGAAGATTACCTCATAGGCAGCGCAGGCCTTTACCACGTAGACCCCTTCCAAAGAGGCCAAATTTCACTGCAACACCCACTACAACAGTGTCACTTACTCAATCTCCAGTCAATAATATAGCA
Associated Phenotype:
Not determined