Busch Lab

ZMP

MAML2

Ensembl ID:
ENSDARG00000076326
Description:
mastermind-like 2 (Drosophila) [Source:HGNC Symbol;Acc:16259]
Human Orthologue:
MAML2
Human Description:
mastermind-like 2 (Drosophila) [Source:HGNC Symbol;Acc:16259]
Mouse Orthologue:
Maml2
Mouse Description:
mastermind like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2389460]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa308 Nonsense F2 line generated Not yet available
sa2814 Nonsense F2 line generated Not yet available
sa10859 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa308
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108486 Nonsense 345 448 1 2
ENSDART00000108486 Nonsense 345 448 1 2
Genomic Location (Zv9):
Chromosome 15 (position 3772789)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4178023
GRCz11 15 3900491
KASP Assay ID:
554-3156.1 (used for ordering genotyping assays)
KASP Sequence:
CAACAACAGCAGGCACCTTCAGCAGGTCAGGGTAGGCACTTTCARAACTG[C/A]CAGCTGCCCATGCAACCATCTTCATGTCTGCAAACTAAGCCTCCAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2814
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108486 Nonsense 345 448 1 2
ENSDART00000108486 Nonsense 345 448 1 2
Genomic Location (Zv9):
Chromosome 15 (position 3772789)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4178023
GRCz11 15 3900491
KASP Assay ID:
554-3156.1 (used for ordering genotyping assays)
KASP Sequence:
CAACAACAGCAGGCACCTTCAGCAGGTCAGGGTAGGCACTTTCARAACTG[C/A]CAGCTGCCCATGCAACCATCTTCATGTCTGCAAACTAAGCCTCCAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10859
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108486 Essential Splice Site 382 448 1 2
Genomic Location (Zv9):
Chromosome 15 (position 3772676)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4177910
GRCz11 15 3900604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATCAACAWGGAGCTGGAATCAGTTTTAAATTGACACARCAGAGACAGG[T/A]AAGTCACTGCATTTAKGGTCTTTTTATTACAGTGCCTACTGTTGCTGTAA
Associated Phenotype:
Not determined