Busch Lab

ZMP

si:dkey-211m23.2

Ensembl ID:
ENSDARG00000076321
ZFIN ID:
ZDB-GENE-030131-4444
Description:
collagen type XXVIII alpha 1 a [Source:RefSeq peptide;Acc:NP_001153314]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9059 Nonsense Mutation detected in F1 DNA Not yet available
sa25439 Nonsense Mutation detected in F1 DNA Not yet available
sa17519 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9059
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115121 Nonsense 103 1208 2 35
ENSDART00000134185 None None 67 None 9
ENSDART00000140185 Nonsense 103 1192 3 36
Genomic Location (Zv9):
Chromosome 9 (position 49347746)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48662816
GRCz11 9 48360211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATAGAAGGCCTCCAGAGYATCCGCTTGGACACAGGCCGCAAACTCAGCT[G/A]GAGAGCRGCCCTGCTCCAGTACAGCAGTCACGTCATCATCGAGCAAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25439
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115121 Nonsense 273 1208 5 35
ENSDART00000134185 None None 67 5 9
ENSDART00000140185 Nonsense 273 1192 6 36
Genomic Location (Zv9):
Chromosome 9 (position 49331799)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48646869
GRCz11 9 48344264
KASP Assay ID:
554-7438.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGATTGACTTCCTACGTTTTTTTTTTTTTTTTTACCCTGCAGGGAAAG[A/T]AGGGTCGTCCAGGTGAGGACGGAACTCCTGGGGCCAAAGGCCAAAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17519
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115121 Nonsense 1056 1208 32 35
ENSDART00000134185 None None 67 None 9
ENSDART00000140185 Nonsense 1040 1192 33 36
Genomic Location (Zv9):
Chromosome 9 (position 49290272)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48605342
GRCz11 9 48302737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTATGGAAGCAGATTTCAGGAGTCACTAGACAGATCGCAGAGTCACACC[A/T]GAGGCAGAGGACACAGTATACCATTACCCATCAGCCCCGGGCCTCTCAAA
Associated Phenotype:
Not determined